Starting /dee2/code/volunteer_pipeline.sh SRR21853447 current disk space = 1550409379840 free memory = 1598523832 SRR21853447 SRAfilesize 0fde3ddd127b161ed6388fbab990455c SRR21853447.sra SRR21853447.sra file validated SRR21853447 is single end SRR21853447 is conventional basespace SRR21853447 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853447_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.127 37.0 37.0 37.0 25.0 37.0 2 34.76025 37.0 37.0 37.0 25.0 37.0 3 35.3775 37.0 37.0 37.0 37.0 37.0 4 35.5055 37.0 37.0 37.0 37.0 37.0 5 35.6775 37.0 37.0 37.0 37.0 37.0 6 35.653 37.0 37.0 37.0 37.0 37.0 7 35.3875 37.0 37.0 37.0 37.0 37.0 8 35.671 37.0 37.0 37.0 37.0 37.0 9 35.7495 37.0 37.0 37.0 37.0 37.0 10-11 35.762 37.0 37.0 37.0 37.0 37.0 12-13 35.711749999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.72825 37.0 37.0 37.0 37.0 37.0 16-17 35.737 37.0 37.0 37.0 37.0 37.0 18-19 35.721000000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.565 37.0 37.0 37.0 37.0 37.0 22-23 35.59625 37.0 37.0 37.0 37.0 37.0 24-25 35.61525 37.0 37.0 37.0 37.0 37.0 26-27 35.52575 37.0 37.0 37.0 37.0 37.0 28-29 35.52175 37.0 37.0 37.0 37.0 37.0 30-31 35.379999999999995 37.0 37.0 37.0 37.0 37.0 32-33 35.4715 37.0 37.0 37.0 37.0 37.0 34-35 35.465 37.0 37.0 37.0 37.0 37.0 36-37 35.37875 37.0 37.0 37.0 37.0 37.0 38-39 35.369 37.0 37.0 37.0 37.0 37.0 40-41 35.441 37.0 37.0 37.0 37.0 37.0 42-43 35.30025 37.0 37.0 37.0 31.0 37.0 44-45 35.3685 37.0 37.0 37.0 37.0 37.0 46-47 35.364999999999995 37.0 37.0 37.0 31.0 37.0 48-49 35.26775 37.0 37.0 37.0 31.0 37.0 50-51 35.284 37.0 37.0 37.0 31.0 37.0 52-53 35.3335 37.0 37.0 37.0 37.0 37.0 54-55 35.307249999999996 37.0 37.0 37.0 37.0 37.0 56-57 35.257000000000005 37.0 37.0 37.0 31.0 37.0 58-59 35.33425 37.0 37.0 37.0 31.0 37.0 60-61 35.22025 37.0 37.0 37.0 25.0 37.0 62-63 35.059749999999994 37.0 37.0 37.0 25.0 37.0 64-65 35.304500000000004 37.0 37.0 37.0 37.0 37.0 66-67 35.16175 37.0 37.0 37.0 25.0 37.0 68-69 35.18175 37.0 37.0 37.0 31.0 37.0 70-71 35.23525 37.0 37.0 37.0 31.0 37.0 72-73 35.14675 37.0 37.0 37.0 25.0 37.0 74-75 35.26525 37.0 37.0 37.0 31.0 37.0 76-77 35.0645 37.0 37.0 37.0 25.0 37.0 78-79 35.21475 37.0 37.0 37.0 25.0 37.0 80-81 35.247 37.0 37.0 37.0 31.0 37.0 82-83 35.178 37.0 37.0 37.0 25.0 37.0 84-85 35.088750000000005 37.0 37.0 37.0 25.0 37.0 86-87 35.198499999999996 37.0 37.0 37.0 25.0 37.0 88-89 35.19025 37.0 37.0 37.0 31.0 37.0 90-91 35.083749999999995 37.0 37.0 37.0 25.0 37.0 92-93 35.07425 37.0 37.0 37.0 25.0 37.0 94-95 35.0055 37.0 37.0 37.0 25.0 37.0 96-97 35.04799510688483 37.0 37.0 37.0 25.0 37.0 98-99 34.963247207282905 37.0 37.0 37.0 25.0 37.0 100-101 34.98339248367559 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 7.0 25 13.0 26 20.0 27 27.0 28 40.0 29 66.0 30 98.0 31 131.0 32 150.0 33 187.0 34 282.0 35 554.0 36 2029.0 37 390.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.999999999999996 13.350000000000001 17.599999999999998 40.050000000000004 2 26.09688054780624 19.604362160791275 30.103981739792037 24.194775551610448 3 27.0 24.099999999999998 23.200000000000003 25.7 4 28.1 29.15 18.95 23.799999999999997 5 27.85 30.975 20.875 20.3 6 22.400000000000002 32.525 21.85 23.225 7 19.55 17.525 38.475 24.45 8 22.15 22.7 24.375 30.775000000000002 9 22.05 22.05 27.375 28.525 10-11 25.837500000000002 28.549999999999997 20.0375 25.575 12-13 24.15 22.5125 26.0625 27.275 14-15 24.3625 24.2 26.150000000000002 25.2875 16-17 24.5125 24.474999999999998 24.0125 27.0 18-19 24.6125 25.7625 24.15 25.474999999999998 20-21 25.2375 25.525 24.1625 25.074999999999996 22-23 24.1125 24.95 24.375 26.5625 24-25 23.599999999999998 25.874999999999996 25.3125 25.2125 26-27 25.2125 24.3 25.0 25.4875 28-29 25.0625 25.2875 24.6 25.05 30-31 23.9125 25.124999999999996 25.25 25.7125 32-33 23.75 25.224999999999998 25.137500000000003 25.887500000000003 34-35 24.4 24.45 24.474999999999998 26.674999999999997 36-37 25.2375 24.5375 24.575 25.650000000000002 38-39 24.474999999999998 25.5125 24.6125 25.4 40-41 24.925 24.4125 24.0625 26.6 42-43 24.2375 25.1875 25.0125 25.5625 44-45 23.175 26.4625 23.549999999999997 26.8125 46-47 24.9125 24.224999999999998 24.462500000000002 26.400000000000002 48-49 24.7 25.2625 24.3875 25.650000000000002 50-51 26.25 25.025 24.474999999999998 24.25 52-53 25.5 25.1875 23.95 25.362499999999997 54-55 24.7875 25.162499999999998 24.725 25.324999999999996 56-57 25.162499999999998 25.5625 24.5125 24.762500000000003 58-59 24.2 24.762500000000003 24.3875 26.650000000000002 60-61 24.4 25.0375 24.2875 26.275 62-63 24.95 24.65 25.2125 25.1875 64-65 25.4625 25.074999999999996 24.0 25.4625 66-67 24.6875 25.5625 24.875 24.875 68-69 26.05 25.25 23.225 25.474999999999998 70-71 24.8625 24.474999999999998 24.6625 26.0 72-73 25.4 24.575 24.762500000000003 25.2625 74-75 26.1625 24.75 24.3875 24.7 76-77 25.412499999999998 24.587500000000002 24.4 25.6 78-79 25.75 24.9875 23.6375 25.624999999999996 80-81 25.374999999999996 24.4 24.725 25.5 82-83 25.275 24.975 24.1125 25.637500000000003 84-85 25.15 24.775 24.8625 25.2125 86-87 26.087500000000002 24.474999999999998 24.1625 25.275 88-89 25.525 25.0375 24.6 24.837500000000002 90-91 25.337500000000002 24.95 24.2875 25.424999999999997 92-93 25.4875 24.625 24.4125 25.474999999999998 94-95 25.75 25.112499999999997 23.525 25.6125 96-97 26.32895559724828 24.60287679799875 24.79049405878674 24.27767354596623 98-99 24.895264694680716 24.51440903897423 24.666751301256824 25.923574965088232 100-101 26.057906458797326 11.613108495068406 30.480432707604198 31.848552338530066 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 1.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.5 24 1.5 25 1.5 26 4.5 27 5.5 28 4.0 29 6.5 30 8.0 31 11.0 32 17.0 33 22.0 34 27.0 35 33.0 36 42.5 37 58.0 38 82.0 39 91.0 40 102.0 41 130.5 42 152.5 43 162.5 44 162.0 45 182.5 46 197.0 47 170.5 48 179.0 49 187.5 50 156.0 51 144.0 52 125.0 53 108.0 54 107.0 55 99.5 56 96.0 57 86.0 58 80.5 59 74.0 60 58.0 61 63.0 62 67.0 63 61.5 64 63.5 65 62.5 66 61.5 67 58.0 68 49.0 69 54.5 70 55.5 71 43.0 72 33.5 73 27.0 74 27.0 75 26.5 76 19.0 77 15.0 78 11.5 79 6.0 80 5.0 81 4.0 82 3.0 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.425 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 1.0 96 3.0 97 22.0 98 71.0 99 275.0 100 970.0 101 2658.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.86993603411514 88.05 2 5.676972281449894 10.65 3 0.42643923240938164 1.2 4 0.026652452025586353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802690 spots for SRR21853447.sra Written 802690 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra Read 802685 spots for SRR21853447.sra Written 802685 spots for SRR21853447.sra SRR ids: ['SRR21853447.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hqc9c2sr SRR21853447.sra spots: 16053705 blocks: [[1, 802685], [802686, 1605370], [1605371, 2408055], [2408056, 3210740], [3210741, 4013425], [4013426, 4816110], [4816111, 5618795], [5618796, 6421480], [6421481, 7224165], [7224166, 8026850], [8026851, 8829535], [8829536, 9632220], [9632221, 10434905], [10434906, 11237590], [11237591, 12040275], [12040276, 12842960], [12842961, 13645645], [13645646, 14448330], [14448331, 15251015], [15251016, 16053705]] SRR21853447 file size 4322837 SRR21853447 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853447 SRR21853447_1.fastq Input file: SRR21853447_1.fastq trimmed: SRR21853447-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:02:46 2024 >> started Fri Dec 6 15:02:53 2024 >> done (7.765s) 16053705 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 25194 ( 0.16%) empty reads filtered out after trimming by size control 16028503 (99.84%) reads available; of these: 438 ( 0.00%) trimmed reads available after processing 16028065 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 8 0.00% 25 3 0.00% 26 6 0.00% 27 3 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 10 0.00% 32 4 0.00% 33 9 0.00% 34 3 0.00% 35 62 0.00% 36 76 0.00% 37 74 0.00% 38 81 0.00% 39 89 0.00% 40 87 0.00% 41 81 0.00% 42 80 0.00% 43 86 0.00% 44 92 0.00% 45 84 0.00% 46 95 0.00% 47 95 0.00% 48 101 0.00% 49 107 0.00% 50 114 0.00% 51 110 0.00% 52 94 0.00% 53 136 0.00% 54 127 0.00% 55 102 0.00% 56 112 0.00% 57 125 0.00% 58 121 0.00% 59 135 0.00% 60 140 0.00% 61 155 0.00% 62 126 0.00% 63 139 0.00% 64 142 0.00% 65 170 0.00% 66 161 0.00% 67 145 0.00% 68 154 0.00% 69 163 0.00% 70 167 0.00% 71 155 0.00% 72 159 0.00% 73 171 0.00% 74 171 0.00% 75 186 0.00% 76 178 0.00% 77 193 0.00% 78 192 0.00% 79 175 0.00% 80 196 0.00% 81 228 0.00% 82 236 0.00% 83 233 0.00% 84 245 0.00% 85 256 0.00% 86 248 0.00% 87 256 0.00% 88 281 0.00% 89 312 0.00% 90 418 0.00% 91 737 0.00% 92 340 0.00% 93 475 0.00% 94 1016 0.01% 95 3786 0.02% 96 21804 0.14% 97 77082 0.48% 98 301069 1.88% 99 1073387 6.70% 100 3697320 23.07% 101 10842807 67.65% 16028503 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=202.06 fanout-score-rank=14 prefix-density=0.77 prefix-fanout=24.1 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=411.03 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=24.7 sequence=CGCCGCCGCCATC Started job on | Dec 06 15:03:11 Started mapping on | Dec 06 15:03:12 Finished on | Dec 06 15:03:43 Mapping speed, Million of reads per hour | 1861.37 Number of input reads | 16028503 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14714805 Uniquely mapped reads % | 91.80% Average mapped length | 100.20 Number of splices: Total | 5047334 Number of splices: Annotated (sjdb) | 4783928 Number of splices: GT/AG | 4978612 Number of splices: GC/AG | 56610 Number of splices: AT/AC | 3002 Number of splices: Non-canonical | 9110 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.24 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280542 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 275701 % of reads mapped to too many loci | 1.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.47% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1033156 1033156 1033156 N_multimapping 280542 280542 280542 N_noFeature 677502 7576783 7623049 N_ambiguous 219538 13638 14689 UnstrandedReadsAssigned:13817765 PositiveStrandReadsAssigned:7124384 NegativeStrandReadsAssigned:7077067 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853447 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853447-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,028,503 reads, 14,187,409 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52973 SRR21853447.ke.tsv 35125 SRR21853447.se.tsv 88098 total ==> SRR21853447.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 87.2741 11.6117 PNS24249 1928 1829 232.039 15.9511 PNS24246 1044 945 87.2741 11.6117 PNS24248 1044 945 87.2741 11.6117 PNS24244 1471 1372 111.138 10.1848 PNS24243 293 194 20 12.962 KQK14069 1603 1504 10477.2 875.873 KQK14071 474 375 1558.01 522.373 ==> SRR21853447.se.tsv <== BRADI_1g14170v3 13299 BRADI_1g53295v3 57 BRADI_1g59795v3 454 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 227 BRADI_1g74790v3 233 BRADI_1g09890v3 0 BRADI_1g77505v3 174 BRADI_1g48960v3 0 SRR21853447 completed mapping pipeline successfully