Starting /dee2/code/volunteer_pipeline.sh SRR21853448 current disk space = 1550419091456 free memory = 1447565904 SRR21853448 SRAfilesize 3175f87659f9e7c975a94cf068675c5f SRR21853448.sra SRR21853448.sra file validated SRR21853448 is single end SRR21853448 is conventional basespace SRR21853448 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.77325 37.0 37.0 37.0 25.0 37.0 2 34.555 37.0 37.0 37.0 25.0 37.0 3 35.45325 37.0 37.0 37.0 37.0 37.0 4 35.49225 37.0 37.0 37.0 37.0 37.0 5 35.87725 37.0 37.0 37.0 37.0 37.0 6 35.69575 37.0 37.0 37.0 37.0 37.0 7 35.56275 37.0 37.0 37.0 37.0 37.0 8 35.94975 37.0 37.0 37.0 37.0 37.0 9 35.75725 37.0 37.0 37.0 37.0 37.0 10-11 35.7475 37.0 37.0 37.0 37.0 37.0 12-13 35.67275 37.0 37.0 37.0 37.0 37.0 14-15 35.775999999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.74925 37.0 37.0 37.0 37.0 37.0 18-19 35.74975 37.0 37.0 37.0 37.0 37.0 20-21 35.713499999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.710499999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.701 37.0 37.0 37.0 37.0 37.0 26-27 35.565250000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.44125 37.0 37.0 37.0 37.0 37.0 30-31 35.5605 37.0 37.0 37.0 37.0 37.0 32-33 35.45425 37.0 37.0 37.0 37.0 37.0 34-35 35.51375 37.0 37.0 37.0 37.0 37.0 36-37 35.47661915478869 37.0 37.0 37.0 37.0 37.0 38-39 35.3970992748187 37.0 37.0 37.0 37.0 37.0 40-41 35.39034758689672 37.0 37.0 37.0 37.0 37.0 42-43 35.37984496124031 37.0 37.0 37.0 37.0 37.0 44-45 35.420105026256564 37.0 37.0 37.0 37.0 37.0 46-47 35.31457864466117 37.0 37.0 37.0 37.0 37.0 48-49 35.351175587793904 37.0 37.0 37.0 37.0 37.0 50-51 35.39069534767384 37.0 37.0 37.0 37.0 37.0 52-53 35.395447723861935 37.0 37.0 37.0 37.0 37.0 54-55 35.42971485742871 37.0 37.0 37.0 37.0 37.0 56-57 35.456228114057026 37.0 37.0 37.0 37.0 37.0 58-59 35.24287143571786 37.0 37.0 37.0 25.0 37.0 60-61 35.32691345672836 37.0 37.0 37.0 37.0 37.0 62-63 35.244683512634474 37.0 37.0 37.0 25.0 37.0 64-65 35.345008756567424 37.0 37.0 37.0 37.0 37.0 66-67 35.229672254190646 37.0 37.0 37.0 25.0 37.0 68-69 35.18638979234426 37.0 37.0 37.0 25.0 37.0 70-71 35.301976482361766 37.0 37.0 37.0 37.0 37.0 72-73 35.266950212659495 37.0 37.0 37.0 31.0 37.0 74-75 35.294470853139856 37.0 37.0 37.0 31.0 37.0 76-77 35.18663997998499 37.0 37.0 37.0 25.0 37.0 78-79 35.10507880910683 37.0 37.0 37.0 25.0 37.0 80-81 35.128846634976234 37.0 37.0 37.0 25.0 37.0 82-83 35.18638979234426 37.0 37.0 37.0 25.0 37.0 84-85 35.071303477608204 37.0 37.0 37.0 25.0 37.0 86-87 35.16163993615832 37.0 37.0 37.0 25.0 37.0 88-89 35.10915359525775 37.0 37.0 37.0 25.0 37.0 90-91 35.081372058087126 37.0 37.0 37.0 25.0 37.0 92-93 34.999499123466066 37.0 37.0 37.0 25.0 37.0 94-95 35.07738542449286 37.0 37.0 37.0 25.0 37.0 96-97 35.142379794694705 37.0 37.0 37.0 25.0 37.0 98-99 35.027236587595254 37.0 37.0 37.0 25.0 37.0 100-101 35.02752722725903 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 5.0 24 10.0 25 10.0 26 10.0 27 21.0 28 43.0 29 59.0 30 86.0 31 100.0 32 150.0 33 215.0 34 313.0 35 605.0 36 2065.0 37 306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.707426856714182 12.628157039259817 18.079519879969993 39.58489622405602 2 26.146788990825687 20.412844036697248 30.198776758409785 23.24159021406728 3 27.056764191047762 24.93123280820205 22.705676419104776 25.30632658164541 4 28.032008002000502 28.00700175043761 19.004751187796952 24.956239059764943 5 27.45686421605401 29.882470617654416 20.455113778444613 22.20555138784696 6 22.83070767691923 32.208052013003254 21.50537634408602 23.455863965991497 7 20.555138784696176 15.828957239309826 39.05976494123531 24.55613903475869 8 22.980745186296573 21.05526381595399 24.431107776944234 31.532883220805203 9 21.780445111277817 21.355338834708675 28.882220555138783 27.981995498874717 10-11 26.019004751187797 27.494373593398347 19.30482620655164 27.181795448862218 12-13 23.605901475368842 22.680670167541887 25.893973493373345 27.819454863715933 14-15 24.093523380845213 24.318579644911228 24.831207801950487 26.756689172293076 16-17 25.618904726181547 23.730932733183295 24.306076519129782 26.344086021505376 18-19 25.006251562890725 24.76869217304326 23.830957739434858 26.39409852463116 20-21 24.93123280820205 24.543635908977244 23.968492123030757 26.556639159789945 22-23 24.956239059764943 24.81870467616904 23.943485871467868 26.281570392598148 24-25 24.668667166791696 24.85621405351338 23.868467116779193 26.60665166291573 26-27 24.468617154288573 25.28132033008252 23.730932733183295 26.51912978244561 28-29 25.618904726181547 24.293573393348336 23.25581395348837 26.831707926981746 30-31 23.63090772693173 25.243810952738183 24.656164041010253 26.469117279319832 32-33 25.806451612903224 23.88097024256064 23.78094523630908 26.531632908227053 34-35 25.056264066016503 25.068767191797946 24.15603900975244 25.71892973243311 36-37 24.731182795698924 24.60615153788447 24.33108277069267 26.331582895723933 38-39 25.431357839459867 24.90622655663916 23.080770192548137 26.581645411352838 40-41 25.806451612903224 24.10602650662666 23.593398349587396 26.494123530882717 42-43 24.99374843710928 24.268567141785446 24.50612653163291 26.231557889472366 44-45 26.069017254313575 23.95598899724931 24.218554638659665 25.756439109777446 46-47 25.76894223555889 24.55613903475869 22.930732683170792 26.744186046511626 48-49 25.100050025012504 24.499749874937468 24.512256128064035 25.887943971985994 50-51 25.212606303151574 24.287143571785894 24.987493746873437 25.512756378189096 52-53 24.73736868434217 24.362181090545274 23.62431215607804 27.276138069034516 54-55 25.18759379689845 24.92496248124062 23.411705852926463 26.475737868934466 56-57 25.050025012506254 24.824912456228116 23.54927463731866 26.575787893946973 58-59 25.512756378189096 24.749874937468736 23.04902451225613 26.688344172086044 60-61 24.862431215607803 25.662831415707853 23.17408704352176 26.300650325162582 62-63 25.569176882662 23.95546659994996 23.430072554415812 27.045283962972228 64-65 25.94445834375782 24.455841881411057 23.767825869402053 25.83187390542907 66-67 26.1195896922692 24.043032274205654 23.755316487365523 26.08206154615962 68-69 25.281461095821868 24.605954465849386 23.53014761070803 26.582436827620715 70-71 25.94445834375782 23.417563172379285 23.91793845384038 26.720040030022517 72-73 25.569176882662 24.55591693770328 23.592694520890667 26.28221165874406 74-75 25.55666750062547 25.21891418563923 23.642732049036777 25.581686264698522 76-77 26.08206154615962 23.980485364023014 22.979734801100825 26.957718288716535 78-79 25.91943957968476 24.39329497122842 23.430072554415812 26.257192894671004 80-81 26.032024018013512 24.55591693770328 23.29246935201401 26.1195896922692 82-83 26.51988991743808 23.642732049036777 23.2424318238679 26.594946209657245 84-85 26.007005253940456 24.305729296972732 23.592694520890667 26.09457092819615 86-87 25.209558363568124 25.12198173401726 23.370449143000123 26.298010759414485 88-89 26.057571964956196 23.90488110137672 24.06758448060075 25.96996245306633 90-91 25.43815723585378 25.0 22.984476715072606 26.577366049073607 92-93 25.6824442774856 24.78086651640371 23.916854495366895 25.6198347107438 94-95 25.79514149762084 24.430252942649634 23.553719008264462 26.22088655146506 96-97 26.629072681704262 23.42105263157895 24.235588972431078 25.71428571428571 98-99 26.052665055336472 22.617987533392697 24.093626765042618 27.235720646228216 100-101 27.897063467003473 10.94095358383328 27.849700031575626 33.31228291758762 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 1.5 27 4.0 28 5.0 29 6.0 30 6.0 31 8.5 32 12.5 33 15.5 34 26.0 35 39.5 36 48.0 37 59.0 38 77.0 39 87.5 40 88.5 41 112.0 42 137.0 43 148.5 44 165.5 45 187.0 46 183.5 47 162.0 48 156.0 49 150.5 50 156.5 51 146.5 52 119.5 53 113.5 54 99.5 55 87.5 56 88.0 57 82.5 58 89.5 59 82.5 60 67.5 61 66.5 62 69.0 63 63.0 64 68.5 65 77.5 66 72.0 67 67.5 68 55.5 69 52.5 70 59.5 71 64.5 72 55.0 73 36.0 74 30.5 75 32.5 76 23.5 77 15.5 78 16.0 79 16.5 80 12.5 81 6.0 82 4.5 83 4.0 84 3.0 85 2.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.9 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 1.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 2.0 90-91 1.0 92-93 0.0 94-95 1.0 96-97 27.0 98-99 341.0 100-101 3624.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.5 #Duplication Level Percentage of deduplicated Percentage of total 1 94.52380952380952 89.325 2 5.158730158730158 9.75 3 0.291005291005291 0.8250000000000001 4 0.026455026455026457 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975888 spots for SRR21853448.sra Written 975888 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra Read 975879 spots for SRR21853448.sra Written 975879 spots for SRR21853448.sra SRR ids: ['SRR21853448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_my1uzihh SRR21853448.sra spots: 19517589 blocks: [[1, 975879], [975880, 1951758], [1951759, 2927637], [2927638, 3903516], [3903517, 4879395], [4879396, 5855274], [5855275, 6831153], [6831154, 7807032], [7807033, 8782911], [8782912, 9758790], [9758791, 10734669], [10734670, 11710548], [11710549, 12686427], [12686428, 13662306], [13662307, 14638185], [14638186, 15614064], [15614065, 16589943], [16589944, 17565822], [17565823, 18541701], [18541702, 19517589]] SRR21853448 file size 5258103 SRR21853448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853448 SRR21853448_1.fastq Input file: SRR21853448_1.fastq trimmed: SRR21853448-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:03:03 2024 >> started Fri Dec 6 15:03:13 2024 >> done (10.458s) 19517589 reads processed; of these: 24 ( 0.00%) short reads filtered out after trimming by size control 31763 ( 0.16%) empty reads filtered out after trimming by size control 19485802 (99.84%) reads available; of these: 636 ( 0.00%) trimmed reads available after processing 19485166 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 5 0.00% 24 5 0.00% 25 0 0.00% 26 2 0.00% 27 6 0.00% 28 10 0.00% 29 9 0.00% 30 18 0.00% 31 10 0.00% 32 7 0.00% 33 4 0.00% 34 12 0.00% 35 116 0.00% 36 123 0.00% 37 115 0.00% 38 137 0.00% 39 150 0.00% 40 142 0.00% 41 137 0.00% 42 122 0.00% 43 152 0.00% 44 140 0.00% 45 148 0.00% 46 157 0.00% 47 169 0.00% 48 155 0.00% 49 155 0.00% 50 125 0.00% 51 152 0.00% 52 160 0.00% 53 186 0.00% 54 180 0.00% 55 205 0.00% 56 187 0.00% 57 175 0.00% 58 213 0.00% 59 198 0.00% 60 219 0.00% 61 185 0.00% 62 213 0.00% 63 184 0.00% 64 229 0.00% 65 210 0.00% 66 250 0.00% 67 232 0.00% 68 229 0.00% 69 214 0.00% 70 248 0.00% 71 237 0.00% 72 249 0.00% 73 226 0.00% 74 248 0.00% 75 240 0.00% 76 232 0.00% 77 270 0.00% 78 298 0.00% 79 303 0.00% 80 282 0.00% 81 286 0.00% 82 312 0.00% 83 314 0.00% 84 349 0.00% 85 388 0.00% 86 356 0.00% 87 367 0.00% 88 393 0.00% 89 495 0.00% 90 532 0.00% 91 901 0.00% 92 438 0.00% 93 609 0.00% 94 1332 0.01% 95 4904 0.03% 96 26038 0.13% 97 88113 0.45% 98 348854 1.79% 99 1295052 6.65% 100 4333469 22.24% 101 13373301 68.63% 19485802 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=22 prefix-density=0.25 prefix-fanout=2.4 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=312.83 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=25.1 sequence=CGCCGCCGCCGTC Started job on | Dec 06 15:03:36 Started mapping on | Dec 06 15:03:36 Finished on | Dec 06 15:04:09 Mapping speed, Million of reads per hour | 2125.72 Number of input reads | 19485802 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18728039 Uniquely mapped reads % | 96.11% Average mapped length | 100.21 Number of splices: Total | 6239249 Number of splices: Annotated (sjdb) | 5895820 Number of splices: GT/AG | 6145642 Number of splices: GC/AG | 78409 Number of splices: AT/AC | 3188 Number of splices: Non-canonical | 12010 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343746 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 138620 % of reads mapped to too many loci | 0.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.30% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414017 414017 414017 N_multimapping 343746 343746 343746 N_noFeature 778132 9644546 9612942 N_ambiguous 289935 22769 20135 UnstrandedReadsAssigned:17659972 PositiveStrandReadsAssigned:9060724 NegativeStrandReadsAssigned:9094962 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853448 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853448-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,485,802 reads, 18,097,006 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR21853448.ke.tsv 35125 SRR21853448.se.tsv 88098 total ==> SRR21853448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 79.0633 8.02743 PNS24249 1928 1829 295.312 15.4918 PNS24246 1044 945 79.0633 8.02743 PNS24248 1044 945 79.0633 8.02743 PNS24244 1471 1372 68.4981 4.79025 PNS24243 293 194 14 6.92404 KQK14069 1603 1504 17509 1116.98 KQK14071 474 375 1867.32 477.771 ==> SRR21853448.se.tsv <== BRADI_1g14170v3 21030 BRADI_1g53295v3 100 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 81 BRADI_1g20270v3 1225 BRADI_1g74790v3 290 BRADI_1g09890v3 15 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR21853448 completed mapping pipeline successfully