Starting /dee2/code/volunteer_pipeline.sh SRR21853449 current disk space = 1550427975680 free memory = 1598885212 SRR21853449 SRAfilesize 635b878241bad091ae4789d8d619c2cf SRR21853449.sra SRR21853449.sra file validated SRR21853449 is single end SRR21853449 is conventional basespace SRR21853449 read1 length is 53-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853449_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0455 37.0 37.0 37.0 25.0 37.0 2 34.81575 37.0 37.0 37.0 25.0 37.0 3 35.513 37.0 37.0 37.0 37.0 37.0 4 35.466 37.0 37.0 37.0 37.0 37.0 5 35.7305 37.0 37.0 37.0 37.0 37.0 6 35.6825 37.0 37.0 37.0 37.0 37.0 7 35.51 37.0 37.0 37.0 37.0 37.0 8 35.694 37.0 37.0 37.0 37.0 37.0 9 35.7205 37.0 37.0 37.0 37.0 37.0 10-11 35.815 37.0 37.0 37.0 37.0 37.0 12-13 35.713 37.0 37.0 37.0 37.0 37.0 14-15 35.83175 37.0 37.0 37.0 37.0 37.0 16-17 35.80525 37.0 37.0 37.0 37.0 37.0 18-19 35.75675 37.0 37.0 37.0 37.0 37.0 20-21 35.703 37.0 37.0 37.0 37.0 37.0 22-23 35.6575 37.0 37.0 37.0 37.0 37.0 24-25 35.69725 37.0 37.0 37.0 37.0 37.0 26-27 35.612750000000005 37.0 37.0 37.0 37.0 37.0 28-29 35.573 37.0 37.0 37.0 37.0 37.0 30-31 35.525000000000006 37.0 37.0 37.0 37.0 37.0 32-33 35.5255 37.0 37.0 37.0 37.0 37.0 34-35 35.47225 37.0 37.0 37.0 37.0 37.0 36-37 35.49225 37.0 37.0 37.0 37.0 37.0 38-39 35.428 37.0 37.0 37.0 37.0 37.0 40-41 35.5005 37.0 37.0 37.0 37.0 37.0 42-43 35.41425 37.0 37.0 37.0 37.0 37.0 44-45 35.36225 37.0 37.0 37.0 37.0 37.0 46-47 35.38975 37.0 37.0 37.0 37.0 37.0 48-49 35.370000000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.337 37.0 37.0 37.0 31.0 37.0 52-53 35.284 37.0 37.0 37.0 31.0 37.0 54-55 35.26106526631658 37.0 37.0 37.0 31.0 37.0 56-57 35.29632408102026 37.0 37.0 37.0 31.0 37.0 58-59 35.26706676669167 37.0 37.0 37.0 31.0 37.0 60-61 35.3218304576144 37.0 37.0 37.0 31.0 37.0 62-63 35.29782445611403 37.0 37.0 37.0 31.0 37.0 64-65 35.16854213553388 37.0 37.0 37.0 25.0 37.0 66-67 35.126531632908225 37.0 37.0 37.0 25.0 37.0 68-69 35.181545386346585 37.0 37.0 37.0 25.0 37.0 70-71 35.08754377188595 37.0 37.0 37.0 25.0 37.0 72-73 35.23136568284142 37.0 37.0 37.0 31.0 37.0 74-75 35.269884942471236 37.0 37.0 37.0 31.0 37.0 76-77 35.22661330665333 37.0 37.0 37.0 25.0 37.0 78-79 35.12882823698564 37.0 37.0 37.0 25.0 37.0 80-81 35.23173173173173 37.0 37.0 37.0 31.0 37.0 82-83 35.24005006257822 37.0 37.0 37.0 25.0 37.0 84-85 35.02053136024438 37.0 37.0 37.0 25.0 37.0 86-87 35.18253902265871 37.0 37.0 37.0 25.0 37.0 88-89 35.17635270541082 37.0 37.0 37.0 31.0 37.0 90-91 35.00627589430929 37.0 37.0 37.0 25.0 37.0 92-93 35.09320972187422 37.0 37.0 37.0 25.0 37.0 94-95 35.063893760962166 37.0 37.0 37.0 25.0 37.0 96-97 35.031754452162396 37.0 37.0 37.0 25.0 37.0 98-99 35.10262056256579 37.0 37.0 37.0 25.0 37.0 100-101 35.079497217910586 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 4.0 24 6.0 25 12.0 26 24.0 27 22.0 28 43.0 29 49.0 30 99.0 31 108.0 32 142.0 33 210.0 34 299.0 35 577.0 36 2026.0 37 376.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.5 12.925 17.474999999999998 40.1 2 25.425019030702867 19.842679522963717 29.51027657954834 25.22202486678508 3 27.200000000000003 23.400000000000002 22.5 26.900000000000002 4 28.4 28.275 17.424999999999997 25.900000000000002 5 28.7 28.825 19.3 23.175 6 24.05 30.725 19.425 25.8 7 20.674999999999997 17.224999999999998 35.975 26.125 8 22.175 22.25 24.375 31.2 9 24.075 19.775000000000002 26.674999999999997 29.475 10-11 26.450000000000003 26.25 19.3625 27.9375 12-13 25.412499999999998 21.725 25.2875 27.575 14-15 25.6 23.200000000000003 23.7375 27.462500000000002 16-17 26.0125 22.7125 23.599999999999998 27.675 18-19 26.150000000000002 22.7 24.099999999999998 27.05 20-21 25.5375 23.7 23.9125 26.85 22-23 25.224999999999998 24.325 23.4625 26.987499999999997 24-25 24.837500000000002 24.725 23.175 27.2625 26-27 25.7625 23.8625 23.075000000000003 27.3 28-29 25.7375 23.9875 23.6625 26.6125 30-31 26.174999999999997 23.724999999999998 23.375 26.724999999999998 32-33 25.900000000000002 23.8875 22.787499999999998 27.425 34-35 26.0375 23.3625 23.1375 27.462500000000002 36-37 25.337500000000002 23.724999999999998 23.5875 27.35 38-39 25.45 24.6 23.0625 26.887499999999996 40-41 25.95 24.2625 23.425 26.3625 42-43 25.924999999999997 23.525 23.425 27.125 44-45 25.174999999999997 23.0875 24.0375 27.700000000000003 46-47 26.0 23.4875 23.25 27.2625 48-49 24.65 23.9 23.9125 27.537499999999998 50-51 26.8375 22.7375 23.799999999999997 26.625 52-53 24.95 23.8625 23.5 27.6875 54-55 25.756439109777446 23.280820205051263 23.418354588647162 27.544386096524132 56-57 25.6064016004001 23.005751437859466 24.093523380845213 27.294323580895224 58-59 25.731432858214554 22.755688922230558 24.5311327831958 26.981745436359088 60-61 26.569142285571395 23.15578894723681 24.131032758189548 26.144036009002253 62-63 25.79394848712178 22.13053263315829 24.20605151287822 27.86946736684171 64-65 25.581395348837212 23.418354588647162 23.730932733183295 27.26931732933233 66-67 26.04401100275069 23.93098274568642 22.868217054263564 27.156789197299325 68-69 24.918729682420604 23.055763940985248 23.980995248812203 28.044511127781945 70-71 25.812906453226613 24.037018509254626 23.774387193596798 26.375687843921963 72-73 26.863431715857928 23.3991995997999 23.774387193596798 25.962981490745374 74-75 26.663331665832917 23.524262131065534 23.036518259129565 26.775887943971988 76-77 26.525762881440716 22.423711855927962 24.599799899949975 26.450725362681343 78-79 26.70419011882427 22.626641651031896 23.97748592870544 26.691682301438398 80-81 26.614114114114113 22.67267267267267 23.34834834834835 27.364864864864863 82-83 27.133917396745932 23.216520650813514 23.554443053817273 26.095118898623284 84-85 27.675553886594066 22.581048942295656 22.96908248842158 26.7743146826887 86-87 26.956303993990232 23.212720671090523 23.788656566921247 26.042318767997997 88-89 26.715931863727455 23.271543086172343 23.609719438877754 26.402805611222448 90-91 26.606538895152198 23.1742452712013 22.735813603908305 27.483402229738196 92-93 26.37183663242295 22.9892257579554 23.565522425457278 27.073415184164368 94-95 27.148584314708092 22.876472062139815 22.237534452518165 27.737409170633924 96-97 26.292670682730922 24.021084337349397 23.079819277108435 26.606425702811244 98-99 27.162695884826093 21.99006242833482 23.77372913746974 27.073512549369344 100-101 28.749212350346564 10.286704473850032 28.875236294896027 32.088846880907376 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 1.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 2.5 29 7.0 30 7.5 31 12.0 32 14.0 33 13.0 34 21.5 35 29.0 36 34.5 37 45.0 38 56.5 39 78.5 40 100.0 41 106.0 42 130.5 43 142.5 44 144.0 45 156.0 46 160.5 47 153.5 48 129.0 49 125.5 50 135.5 51 129.5 52 127.0 53 116.0 54 98.0 55 88.5 56 91.5 57 99.5 58 94.5 59 89.0 60 88.5 61 85.0 62 81.5 63 77.5 64 80.0 65 75.5 66 76.5 67 88.0 68 82.5 69 76.0 70 76.5 71 69.0 72 62.5 73 53.5 74 36.5 75 38.0 76 36.0 77 25.5 78 21.0 79 13.5 80 6.0 81 3.5 82 2.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4749999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 1.0 79 1.0 80 0.0 81 1.0 82 0.0 83 0.0 84 1.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 2.0 96 10.0 97 20.0 98 69.0 99 259.0 100 914.0 101 2717.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.6347941567065 89.075 2 4.940239043824701 9.3 3 0.3187250996015936 0.8999999999999999 4 0.05312084993359894 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02656042496679947 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02656042496679947 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 7 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCGCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904491 spots for SRR21853449.sra Written 904491 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra Read 904478 spots for SRR21853449.sra Written 904478 spots for SRR21853449.sra SRR ids: ['SRR21853449.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ai7np76b SRR21853449.sra spots: 18089573 blocks: [[1, 904478], [904479, 1808956], [1808957, 2713434], [2713435, 3617912], [3617913, 4522390], [4522391, 5426868], [5426869, 6331346], [6331347, 7235824], [7235825, 8140302], [8140303, 9044780], [9044781, 9949258], [9949259, 10853736], [10853737, 11758214], [11758215, 12662692], [12662693, 13567170], [13567171, 14471648], [14471649, 15376126], [15376127, 16280604], [16280605, 17185082], [17185083, 18089573]] SRR21853449 file size 4872986 SRR21853449 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853449 SRR21853449_1.fastq Input file: SRR21853449_1.fastq trimmed: SRR21853449-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:04:00 2024 >> started Fri Dec 6 15:04:10 2024 >> done (9.782s) 18089573 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 100390 ( 0.55%) empty reads filtered out after trimming by size control 17989175 (99.44%) reads available; of these: 511 ( 0.00%) trimmed reads available after processing 17988664 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 5 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 2 0.00% 27 6 0.00% 28 6 0.00% 29 2 0.00% 30 3 0.00% 31 9 0.00% 32 7 0.00% 33 3 0.00% 34 11 0.00% 35 78 0.00% 36 92 0.00% 37 86 0.00% 38 89 0.00% 39 104 0.00% 40 85 0.00% 41 88 0.00% 42 89 0.00% 43 85 0.00% 44 99 0.00% 45 111 0.00% 46 129 0.00% 47 114 0.00% 48 124 0.00% 49 107 0.00% 50 145 0.00% 51 138 0.00% 52 156 0.00% 53 167 0.00% 54 144 0.00% 55 139 0.00% 56 169 0.00% 57 170 0.00% 58 186 0.00% 59 191 0.00% 60 198 0.00% 61 182 0.00% 62 205 0.00% 63 205 0.00% 64 229 0.00% 65 243 0.00% 66 245 0.00% 67 204 0.00% 68 248 0.00% 69 243 0.00% 70 256 0.00% 71 288 0.00% 72 250 0.00% 73 302 0.00% 74 295 0.00% 75 278 0.00% 76 337 0.00% 77 349 0.00% 78 389 0.00% 79 383 0.00% 80 432 0.00% 81 404 0.00% 82 447 0.00% 83 464 0.00% 84 467 0.00% 85 516 0.00% 86 510 0.00% 87 551 0.00% 88 588 0.00% 89 617 0.00% 90 741 0.00% 91 1147 0.01% 92 727 0.00% 93 919 0.01% 94 1696 0.01% 95 5093 0.03% 96 24510 0.14% 97 79157 0.44% 98 315184 1.75% 99 1193742 6.64% 100 3921164 21.80% 101 12431612 69.11% 17989175 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=323.09 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=26.3 sequence=GCCGCCGCCACC Started job on | Dec 06 15:04:27 Started mapping on | Dec 06 15:04:28 Finished on | Dec 06 15:04:58 Mapping speed, Million of reads per hour | 2158.70 Number of input reads | 17989175 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17004524 Uniquely mapped reads % | 94.53% Average mapped length | 100.22 Number of splices: Total | 5502067 Number of splices: Annotated (sjdb) | 5193540 Number of splices: GT/AG | 5419184 Number of splices: GC/AG | 69546 Number of splices: AT/AC | 2921 Number of splices: Non-canonical | 10416 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 417310 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 303247 % of reads mapped to too many loci | 1.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567341 567341 567341 N_multimapping 417310 417310 417310 N_noFeature 697617 8702024 8771158 N_ambiguous 262084 16129 18570 UnstrandedReadsAssigned:16044823 PositiveStrandReadsAssigned:8286371 NegativeStrandReadsAssigned:8214796 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853449 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853449-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,989,175 reads, 16,465,460 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR21853449.ke.tsv 35125 SRR21853449.se.tsv 88098 total ==> SRR21853449.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 57.1653 6.95099 PNS24247 1044 945 48.2195 5.19315 PNS24249 1928 1829 204.247 11.3653 PNS24246 1044 945 48.2195 5.19315 PNS24248 1044 945 48.2195 5.19315 PNS24244 1471 1372 47.9296 3.55541 PNS24243 293 194 21 11.0169 KQK14069 1603 1504 18986.4 1284.8 KQK14071 474 375 2957.84 802.755 ==> SRR21853449.se.tsv <== BRADI_1g14170v3 23465 BRADI_1g53295v3 96 BRADI_1g59795v3 321 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 1248 BRADI_1g74790v3 337 BRADI_1g09890v3 3 BRADI_1g77505v3 257 BRADI_1g48960v3 0 SRR21853449 completed mapping pipeline successfully