Starting /dee2/code/volunteer_pipeline.sh SRR21853450 current disk space = 1550457466880 free memory = 1599758496 SRR21853450 SRAfilesize dc2db4e3af4b124fd8a64883e6e9fcfc SRR21853450.sra SRR21853450.sra file validated SRR21853450 is single end SRR21853450 is conventional basespace SRR21853450 read1 length is 64-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853450_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 64-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.027 37.0 37.0 37.0 25.0 37.0 2 34.67225 37.0 37.0 37.0 25.0 37.0 3 35.393 37.0 37.0 37.0 37.0 37.0 4 35.501 37.0 37.0 37.0 37.0 37.0 5 35.631 37.0 37.0 37.0 37.0 37.0 6 35.693 37.0 37.0 37.0 37.0 37.0 7 35.607 37.0 37.0 37.0 37.0 37.0 8 35.72 37.0 37.0 37.0 37.0 37.0 9 35.7525 37.0 37.0 37.0 37.0 37.0 10-11 35.7425 37.0 37.0 37.0 37.0 37.0 12-13 35.719750000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.6155 37.0 37.0 37.0 37.0 37.0 16-17 35.688500000000005 37.0 37.0 37.0 37.0 37.0 18-19 35.70725 37.0 37.0 37.0 37.0 37.0 20-21 35.74725 37.0 37.0 37.0 37.0 37.0 22-23 35.66525 37.0 37.0 37.0 37.0 37.0 24-25 35.7445 37.0 37.0 37.0 37.0 37.0 26-27 35.48525 37.0 37.0 37.0 37.0 37.0 28-29 35.461749999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.556 37.0 37.0 37.0 37.0 37.0 32-33 35.5075 37.0 37.0 37.0 37.0 37.0 34-35 35.547 37.0 37.0 37.0 37.0 37.0 36-37 35.44275 37.0 37.0 37.0 37.0 37.0 38-39 35.451 37.0 37.0 37.0 37.0 37.0 40-41 35.56075 37.0 37.0 37.0 37.0 37.0 42-43 35.454 37.0 37.0 37.0 37.0 37.0 44-45 35.4685 37.0 37.0 37.0 37.0 37.0 46-47 35.35225 37.0 37.0 37.0 37.0 37.0 48-49 35.33775 37.0 37.0 37.0 37.0 37.0 50-51 35.375249999999994 37.0 37.0 37.0 37.0 37.0 52-53 35.42025 37.0 37.0 37.0 37.0 37.0 54-55 35.455 37.0 37.0 37.0 37.0 37.0 56-57 35.413250000000005 37.0 37.0 37.0 37.0 37.0 58-59 35.383250000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.36625 37.0 37.0 37.0 37.0 37.0 62-63 35.3735 37.0 37.0 37.0 37.0 37.0 64-65 35.30504019754939 37.0 37.0 37.0 37.0 37.0 66-67 35.22355588897224 37.0 37.0 37.0 31.0 37.0 68-69 35.269067266816705 37.0 37.0 37.0 31.0 37.0 70-71 35.167041760440114 37.0 37.0 37.0 25.0 37.0 72-73 35.31307826956739 37.0 37.0 37.0 31.0 37.0 74-75 35.2240560140035 37.0 37.0 37.0 25.0 37.0 76-77 35.09077269317329 37.0 37.0 37.0 25.0 37.0 78-79 35.21855463865967 37.0 37.0 37.0 31.0 37.0 80-81 35.21955488872218 37.0 37.0 37.0 31.0 37.0 82-83 35.18729682420605 37.0 37.0 37.0 25.0 37.0 84-85 35.10577644411103 37.0 37.0 37.0 25.0 37.0 86-87 35.1695423855964 37.0 37.0 37.0 25.0 37.0 88-89 35.27006751687922 37.0 37.0 37.0 31.0 37.0 90-91 35.163790947736935 37.0 37.0 37.0 31.0 37.0 92-93 35.13803450862716 37.0 37.0 37.0 25.0 37.0 94-95 35.15532935259828 37.0 37.0 37.0 31.0 37.0 96-97 35.148922548410184 37.0 37.0 37.0 25.0 37.0 98-99 35.169034190263645 37.0 37.0 37.0 25.0 37.0 100-101 35.078190832544045 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 3.0 24 4.0 25 7.0 26 17.0 27 32.0 28 45.0 29 63.0 30 75.0 31 114.0 32 147.0 33 220.0 34 268.0 35 554.0 36 2102.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.15 12.875 18.3 39.675 2 25.450850901701806 18.92303784607569 32.38506477012954 23.241046482092965 3 26.375 22.75 23.625 27.250000000000004 4 27.275 29.525000000000002 17.8 25.4 5 28.275 29.975 19.55 22.2 6 22.0 32.125 21.099999999999998 24.775 7 18.625 16.900000000000002 40.699999999999996 23.775 8 23.974999999999998 20.7 24.8 30.525000000000002 9 21.375 20.9 27.55 30.175 10-11 25.0375 27.85 21.0125 26.1 12-13 23.4875 22.8875 25.912499999999998 27.712500000000002 14-15 23.3375 24.325 25.8 26.5375 16-17 24.525 23.974999999999998 24.6875 26.8125 18-19 24.762500000000003 23.9875 24.762500000000003 26.487500000000004 20-21 23.7875 24.2625 24.8625 27.0875 22-23 24.712500000000002 25.112499999999997 23.925 26.25 24-25 24.4375 25.1875 24.05 26.325 26-27 25.05 24.325 24.0625 26.5625 28-29 24.325 23.875 25.074999999999996 26.724999999999998 30-31 23.2875 24.7375 25.2625 26.7125 32-33 24.7375 24.7375 24.4375 26.087500000000002 34-35 24.637500000000003 23.849999999999998 25.05 26.4625 36-37 24.7 24.2375 24.075 26.987499999999997 38-39 24.6875 25.724999999999998 23.6875 25.900000000000002 40-41 25.074999999999996 25.112499999999997 24.0 25.8125 42-43 24.675 24.6625 24.837500000000002 25.825 44-45 23.8625 24.6625 24.65 26.825 46-47 24.675 24.712500000000002 24.6 26.0125 48-49 24.962500000000002 25.0625 24.1375 25.837500000000002 50-51 25.112499999999997 23.775 25.112499999999997 26.0 52-53 25.7375 24.2625 24.1625 25.837500000000002 54-55 25.2375 24.6 23.775 26.387500000000003 56-57 25.6125 24.575 23.375 26.437500000000004 58-59 24.762500000000003 24.462500000000002 24.0625 26.7125 60-61 25.174999999999997 24.5625 23.7625 26.5 62-63 25.2 24.0625 24.675 26.0625 64-65 25.55319414926866 23.452931616452055 24.54056757094637 26.453306663332913 66-67 25.29382345586397 24.656164041010253 24.031007751937985 26.019004751187797 68-69 25.28132033008252 24.36859214803701 24.406101525381345 25.943985996499126 70-71 24.643660915228807 24.956239059764943 23.78094523630908 26.619154788697173 72-73 25.018754688672168 23.943485871467868 24.468617154288573 26.569142285571395 74-75 25.381345336334082 24.143535883970994 24.60615153788447 25.868967241810452 76-77 25.331332833208304 24.956239059764943 24.01850462615654 25.693923480870218 78-79 24.756189047261813 24.23105776444111 24.76869217304326 26.244061015253813 80-81 25.10627656914228 25.51887971992998 23.143285821455365 26.231557889472366 82-83 25.343835958989747 24.20605151287822 24.418604651162788 26.03150787696924 84-85 24.168542135533883 24.168542135533883 24.69367341835459 26.969242310577645 86-87 25.456364091022753 23.918479619904975 24.131032758189548 26.494123530882717 88-89 25.51887971992998 24.8062015503876 24.006001500375092 25.668917229307326 90-91 24.518629657414355 24.23105776444111 25.268817204301076 25.98149537384346 92-93 24.681170292573142 23.63090772693173 24.893723430857715 26.79419854963741 94-95 25.62210829060898 25.23446292359635 24.109040890333873 25.034387895460796 96-97 24.956195244055067 24.4180225281602 23.591989987484354 27.033792240300375 98-99 25.428245146555007 22.77629742418475 24.1847481284101 27.610709300850147 100-101 25.96711041503524 11.041503523884105 30.117462803445576 32.873923257635084 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 4.0 29 4.5 30 5.5 31 9.0 32 13.5 33 18.0 34 17.5 35 24.0 36 35.0 37 50.5 38 75.0 39 87.0 40 96.0 41 117.0 42 143.0 43 158.0 44 177.0 45 192.0 46 189.5 47 184.0 48 196.0 49 189.0 50 151.0 51 131.5 52 119.0 53 121.5 54 114.0 55 99.0 56 96.5 57 94.0 58 79.0 59 75.0 60 83.5 61 75.5 62 68.5 63 70.5 64 69.0 65 62.5 66 64.5 67 58.0 68 50.0 69 51.0 70 52.0 71 44.5 72 45.5 73 40.5 74 23.5 75 20.5 76 16.0 77 10.5 78 6.0 79 5.5 80 7.0 81 3.0 82 2.0 83 3.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 1.0 95 1.0 96 4.0 97 18.0 98 69.0 99 257.0 100 913.0 101 2736.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.3796394485684 89.0 2 5.249204665959703 9.9 3 0.3181336161187699 0.8999999999999999 4 0.05302226935312832 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023809 spots for SRR21853450.sra Written 1023809 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra Read 1023801 spots for SRR21853450.sra Written 1023801 spots for SRR21853450.sra SRR ids: ['SRR21853450.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w2bin_on SRR21853450.sra spots: 20476028 blocks: [[1, 1023801], [1023802, 2047602], [2047603, 3071403], [3071404, 4095204], [4095205, 5119005], [5119006, 6142806], [6142807, 7166607], [7166608, 8190408], [8190409, 9214209], [9214210, 10238010], [10238011, 11261811], [11261812, 12285612], [12285613, 13309413], [13309414, 14333214], [14333215, 15357015], [15357016, 16380816], [16380817, 17404617], [17404618, 18428418], [18428419, 19452219], [19452220, 20476028]] SRR21853450 file size 5516508 SRR21853450 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853450 SRR21853450_1.fastq Input file: SRR21853450_1.fastq trimmed: SRR21853450-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:04:40 2024 >> started Fri Dec 6 15:04:51 2024 >> done (10.568s) 20476028 reads processed; of these: 20 ( 0.00%) short reads filtered out after trimming by size control 27046 ( 0.13%) empty reads filtered out after trimming by size control 20448962 (99.87%) reads available; of these: 484 ( 0.00%) trimmed reads available after processing 20448478 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 7 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 7 0.00% 28 4 0.00% 29 6 0.00% 30 4 0.00% 31 7 0.00% 32 7 0.00% 33 7 0.00% 34 7 0.00% 35 125 0.00% 36 105 0.00% 37 102 0.00% 38 130 0.00% 39 94 0.00% 40 132 0.00% 41 107 0.00% 42 143 0.00% 43 123 0.00% 44 151 0.00% 45 125 0.00% 46 123 0.00% 47 165 0.00% 48 110 0.00% 49 137 0.00% 50 160 0.00% 51 153 0.00% 52 161 0.00% 53 158 0.00% 54 165 0.00% 55 167 0.00% 56 166 0.00% 57 147 0.00% 58 155 0.00% 59 198 0.00% 60 208 0.00% 61 198 0.00% 62 166 0.00% 63 206 0.00% 64 180 0.00% 65 200 0.00% 66 189 0.00% 67 197 0.00% 68 201 0.00% 69 215 0.00% 70 203 0.00% 71 214 0.00% 72 213 0.00% 73 264 0.00% 74 243 0.00% 75 222 0.00% 76 232 0.00% 77 234 0.00% 78 230 0.00% 79 278 0.00% 80 296 0.00% 81 334 0.00% 82 308 0.00% 83 277 0.00% 84 313 0.00% 85 340 0.00% 86 351 0.00% 87 352 0.00% 88 395 0.00% 89 425 0.00% 90 572 0.00% 91 1109 0.01% 92 493 0.00% 93 663 0.00% 94 1511 0.01% 95 5041 0.02% 96 27622 0.14% 97 94409 0.46% 98 373265 1.83% 99 1376491 6.73% 100 4621353 22.60% 101 13935161 68.15% 20448962 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=13 prefix-density=0.41 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=186.66 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=23.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:05:09 Started mapping on | Dec 06 15:05:09 Finished on | Dec 06 15:05:33 Mapping speed, Million of reads per hour | 3067.34 Number of input reads | 20448962 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19316752 Uniquely mapped reads % | 94.46% Average mapped length | 100.23 Number of splices: Total | 7103341 Number of splices: Annotated (sjdb) | 6760615 Number of splices: GT/AG | 7003940 Number of splices: GC/AG | 85303 Number of splices: AT/AC | 3684 Number of splices: Non-canonical | 10414 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559214 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 299981 % of reads mapped to too many loci | 1.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.13% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 572996 572996 572996 N_multimapping 559214 559214 559214 N_noFeature 663229 9893576 9826630 N_ambiguous 296795 19708 19622 UnstrandedReadsAssigned:18356728 PositiveStrandReadsAssigned:9403468 NegativeStrandReadsAssigned:9470500 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853450 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853450-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,448,962 reads, 18,872,490 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52973 SRR21853450.ke.tsv 35125 SRR21853450.se.tsv 88098 total ==> SRR21853450.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 79.1119 8.39308 PNS24247 1044 945 44.6652 4.19703 PNS24249 1928 1829 176.866 8.58689 PNS24246 1044 945 44.6652 4.19703 PNS24248 1044 945 44.6652 4.19703 PNS24244 1471 1372 25.0267 1.61978 PNS24243 293 194 13 5.95041 KQK14069 1603 1504 2844.62 167.951 KQK14071 474 375 499.123 118.19 ==> SRR21853450.se.tsv <== BRADI_1g14170v3 3594 BRADI_1g53295v3 78 BRADI_1g59795v3 256 BRADI_1g07683v3 0 BRADI_1g00485v3 109 BRADI_1g20270v3 2270 BRADI_1g74790v3 230 BRADI_1g09890v3 5 BRADI_1g77505v3 256 BRADI_1g48960v3 0 SRR21853450 completed mapping pipeline successfully