Starting /dee2/code/volunteer_pipeline.sh SRR21853451 current disk space = 1550453260288 free memory = 1338685448 SRR21853451 SRAfilesize ebe19c6702928546dfd0b3569e650776 SRR21853451.sra SRR21853451.sra file validated SRR21853451 is single end SRR21853451 is conventional basespace SRR21853451 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.96675 37.0 37.0 37.0 25.0 37.0 2 34.6715 37.0 37.0 37.0 25.0 37.0 3 35.33475 37.0 37.0 37.0 37.0 37.0 4 35.45875 37.0 37.0 37.0 37.0 37.0 5 35.73725 37.0 37.0 37.0 37.0 37.0 6 35.81775 37.0 37.0 37.0 37.0 37.0 7 35.48675 37.0 37.0 37.0 37.0 37.0 8 35.73775 37.0 37.0 37.0 37.0 37.0 9 35.57775 37.0 37.0 37.0 37.0 37.0 10-11 35.763999999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.699749999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.75475 37.0 37.0 37.0 37.0 37.0 16-17 35.7145 37.0 37.0 37.0 37.0 37.0 18-19 35.63125 37.0 37.0 37.0 37.0 37.0 20-21 35.655249999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.66175 37.0 37.0 37.0 37.0 37.0 24-25 35.61175 37.0 37.0 37.0 37.0 37.0 26-27 35.525 37.0 37.0 37.0 37.0 37.0 28-29 35.49825 37.0 37.0 37.0 37.0 37.0 30-31 35.47325 37.0 37.0 37.0 37.0 37.0 32-33 35.4885 37.0 37.0 37.0 37.0 37.0 34-35 35.442 37.0 37.0 37.0 37.0 37.0 36-37 35.41155866900175 37.0 37.0 37.0 37.0 37.0 38-39 35.429572179134354 37.0 37.0 37.0 37.0 37.0 40-41 35.37177883412559 37.0 37.0 37.0 37.0 37.0 42-43 35.3440080060045 37.0 37.0 37.0 37.0 37.0 44-45 35.51463597698273 37.0 37.0 37.0 37.0 37.0 46-47 35.30172629472104 37.0 37.0 37.0 31.0 37.0 48-49 35.38353765323993 37.0 37.0 37.0 37.0 37.0 50-51 35.405053790342755 37.0 37.0 37.0 37.0 37.0 52-53 35.34776082061546 37.0 37.0 37.0 37.0 37.0 54-55 35.379321528183176 37.0 37.0 37.0 37.0 37.0 56-57 35.40665665665666 37.0 37.0 37.0 37.0 37.0 58-59 35.28653653653654 37.0 37.0 37.0 31.0 37.0 60-61 35.33883883883884 37.0 37.0 37.0 37.0 37.0 62-63 35.3470970970971 37.0 37.0 37.0 37.0 37.0 64-65 35.34084084084084 37.0 37.0 37.0 37.0 37.0 66-67 35.28185231539425 37.0 37.0 37.0 31.0 37.0 68-69 35.289361702127664 37.0 37.0 37.0 31.0 37.0 70-71 35.25356695869837 37.0 37.0 37.0 31.0 37.0 72-73 35.23482169436883 37.0 37.0 37.0 31.0 37.0 74-75 35.237403575302835 37.0 37.0 37.0 31.0 37.0 76-77 35.09644288577154 37.0 37.0 37.0 25.0 37.0 78-79 35.146042084168336 37.0 37.0 37.0 25.0 37.0 80-81 35.18186372745491 37.0 37.0 37.0 25.0 37.0 82-83 35.232715430861724 37.0 37.0 37.0 25.0 37.0 84-85 35.13476953907816 37.0 37.0 37.0 25.0 37.0 86-87 35.26503006012024 37.0 37.0 37.0 31.0 37.0 88-89 35.342685370741485 37.0 37.0 37.0 37.0 37.0 90-91 35.17985971943888 37.0 37.0 37.0 31.0 37.0 92-93 35.2124248496994 37.0 37.0 37.0 31.0 37.0 94-95 35.114478957915836 37.0 37.0 37.0 25.0 37.0 96-97 35.08634441301615 37.0 37.0 37.0 25.0 37.0 98-99 35.10765558814357 37.0 37.0 37.0 25.0 37.0 100-101 34.98366383443873 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 6.0 24 5.0 25 12.0 26 19.0 27 34.0 28 43.0 29 64.0 30 69.0 31 119.0 32 156.0 33 192.0 34 263.0 35 528.0 36 2112.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.145359019264447 16.787590693019766 16.38729046785089 39.6797598198649 2 26.38395124428644 19.553072625698324 28.36465210766887 25.69832402234637 3 25.268951713785338 20.040030022516888 23.042281711283465 31.64873655241431 4 27.495621716287218 24.818613960470355 18.663997998498875 29.02176632474356 5 28.521391043282463 27.420565424068048 21.36602451838879 22.692019014260694 6 23.367525644233176 32.79959969977483 20.590442832124094 23.2424318238679 7 19.96497373029772 21.591193395046286 37.0778083562672 21.36602451838879 8 22.66700025018764 23.367525644233176 26.019514635976982 27.9459594696022 9 22.466850137603203 22.316737553164874 28.996747560670507 26.21966474856142 10-11 24.83112334250688 28.183637728296222 23.19239429572179 23.792844633475106 12-13 23.492619464598448 24.430823117338004 25.969477107830873 26.10708031023267 14-15 23.367525644233176 24.68101075806855 25.31898924193145 26.632474355766828 16-17 24.34325744308231 25.281461095821868 25.569176882662 24.806104578433825 18-19 23.555166374781088 25.9819864898674 25.21891418563923 25.243932949712285 20-21 24.00550412809607 25.66925193895422 25.01876407305479 25.30647985989492 22-23 23.2424318238679 26.28221165874406 25.081310983237426 25.39404553415061 24-25 24.55591693770328 25.894420815611706 24.993745308981737 24.55591693770328 26-27 24.931198398799097 24.31823867900926 25.281461095821868 25.469101826369776 28-29 24.31823867900926 25.531648736552416 25.40655491618714 24.74355766825119 30-31 23.455091318488865 25.168876657493122 26.21966474856142 25.156367275456592 32-33 24.330748061045785 25.569176882662 24.981235926945207 25.11883912934701 34-35 24.193144858643983 25.619214410808105 25.544158118588946 24.64348261195897 36-37 24.34325744308231 25.03127345509132 25.056292219164373 25.569176882662 38-39 24.48086064548411 26.032024018013512 24.39329497122842 25.093820365273956 40-41 24.25569176882662 25.8443832874656 24.843632724543408 25.056292219164373 42-43 23.092319239429575 25.21891418563923 26.144608456342254 25.544158118588946 44-45 24.44333249937453 26.45734300725544 24.418313735301474 24.68101075806855 46-47 24.0180135101326 26.35726795096322 24.943707780835627 24.68101075806855 48-49 24.83112334250688 25.30647985989492 24.943707780835627 24.91868901676257 50-51 24.518388791593697 26.257192894671004 25.068801601200903 24.1556167125344 52-53 23.8804103077308 26.38228671503628 24.430823117338004 25.30647985989492 54-55 25.534842987614166 25.684974352558488 24.433879644689103 24.346303015138247 56-57 23.986486486486484 25.513013013013015 24.44944944944945 26.05105105105105 58-59 24.84984984984985 25.93843843843844 24.587087087087088 24.624624624624623 60-61 24.64964964964965 25.68818818818819 24.587087087087088 25.075075075075077 62-63 23.773773773773772 25.675675675675674 25.763263263263266 24.78728728728729 64-65 24.074074074074073 26.83933933933934 24.2992992992993 24.78728728728729 66-67 24.155193992490613 25.857321652065078 25.319148936170212 24.668335419274094 68-69 24.518147684605758 25.744680851063826 24.4180225281602 25.319148936170212 70-71 25.344180225281605 25.20650813516896 25.168961201501876 24.28035043804756 72-73 25.122042808862183 25.334835398673178 25.097008386531485 24.446113405933158 74-75 24.30503380916604 26.34610568494866 24.430252942649634 24.91860756323566 76-77 24.261022044088175 26.44038076152305 24.273547094188377 25.025050100200403 78-79 24.423847695390783 25.889278557114224 25.125250501002007 24.561623246492985 80-81 25.37575150300601 25.60120240480962 24.549098196392784 24.473947895791586 82-83 25.212925851703403 25.0 24.774549098196395 25.012525050100198 84-85 24.37374749498998 25.56362725450902 25.0501002004008 25.012525050100198 86-87 24.611723446893787 25.56362725450902 24.511523046092183 25.313126252505008 88-89 24.498997995991985 25.175350701402806 25.63877755511022 24.68687374749499 90-91 24.549098196392784 25.58867735470942 24.9749498997996 24.887274549098194 92-93 24.261022044088175 25.363226452905813 25.35070140280561 25.025050100200403 94-95 25.125250501002007 25.225450901803608 25.58867735470942 24.06062124248497 96-97 24.467017807875596 24.617506897416604 25.884123401053422 25.031351893654374 98-99 24.248981670061102 24.55448065173116 25.738289205702646 25.45824847250509 100-101 24.992066010790225 10.996509044747699 31.91050460171374 32.10092034274833 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 3.0 27 2.0 28 4.5 29 6.0 30 9.0 31 13.0 32 17.5 33 20.0 34 25.0 35 36.0 36 45.5 37 65.5 38 87.0 39 103.0 40 125.0 41 142.5 42 172.0 43 197.0 44 200.5 45 203.0 46 207.5 47 198.5 48 184.5 49 177.0 50 152.0 51 142.0 52 134.5 53 112.5 54 100.0 55 95.0 56 84.5 57 70.0 58 69.5 59 77.0 60 65.5 61 51.0 62 52.5 63 52.5 64 52.0 65 51.5 66 50.0 67 46.5 68 41.0 69 40.0 70 36.0 71 26.5 72 26.0 73 24.0 74 20.0 75 16.5 76 10.0 77 12.0 78 11.5 79 7.5 80 7.0 81 6.0 82 4.0 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.55 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 3.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 1.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 1.0 74-75 2.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 28.0 98-99 326.0 100-101 3637.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.27511264245958 88.925 2 5.459846276172807 10.299999999999999 3 0.23853697323085077 0.675 4 0.026504108136761195 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0125 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905644 spots for SRR21853451.sra Written 905644 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra Read 905640 spots for SRR21853451.sra Written 905640 spots for SRR21853451.sra SRR ids: ['SRR21853451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6bczb2h SRR21853451.sra spots: 18112804 blocks: [[1, 905640], [905641, 1811280], [1811281, 2716920], [2716921, 3622560], [3622561, 4528200], [4528201, 5433840], [5433841, 6339480], [6339481, 7245120], [7245121, 8150760], [8150761, 9056400], [9056401, 9962040], [9962041, 10867680], [10867681, 11773320], [11773321, 12678960], [12678961, 13584600], [13584601, 14490240], [14490241, 15395880], [15395881, 16301520], [16301521, 17207160], [17207161, 18112804]] SRR21853451 file size 4876038 SRR21853451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853451 SRR21853451_1.fastq Input file: SRR21853451_1.fastq trimmed: SRR21853451-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:07:23 2024 >> started Fri Dec 6 15:07:32 2024 >> done (9.147s) 18112804 reads processed; of these: 61 ( 0.00%) short reads filtered out after trimming by size control 41803 ( 0.23%) empty reads filtered out after trimming by size control 18070940 (99.77%) reads available; of these: 613 ( 0.00%) trimmed reads available after processing 18070327 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 2 0.00% 22 6 0.00% 23 5 0.00% 24 7 0.00% 25 8 0.00% 26 6 0.00% 27 5 0.00% 28 9 0.00% 29 3 0.00% 30 7 0.00% 31 8 0.00% 32 16 0.00% 33 3 0.00% 34 10 0.00% 35 172 0.00% 36 194 0.00% 37 223 0.00% 38 224 0.00% 39 181 0.00% 40 199 0.00% 41 204 0.00% 42 197 0.00% 43 203 0.00% 44 220 0.00% 45 210 0.00% 46 219 0.00% 47 274 0.00% 48 271 0.00% 49 240 0.00% 50 268 0.00% 51 266 0.00% 52 302 0.00% 53 306 0.00% 54 267 0.00% 55 294 0.00% 56 322 0.00% 57 356 0.00% 58 322 0.00% 59 357 0.00% 60 446 0.00% 61 437 0.00% 62 490 0.00% 63 444 0.00% 64 458 0.00% 65 461 0.00% 66 458 0.00% 67 475 0.00% 68 572 0.00% 69 535 0.00% 70 584 0.00% 71 683 0.00% 72 721 0.00% 73 735 0.00% 74 834 0.00% 75 745 0.00% 76 739 0.00% 77 798 0.00% 78 833 0.00% 79 904 0.01% 80 933 0.01% 81 1103 0.01% 82 1135 0.01% 83 1308 0.01% 84 1373 0.01% 85 1351 0.01% 86 1334 0.01% 87 1402 0.01% 88 1493 0.01% 89 1677 0.01% 90 1762 0.01% 91 2362 0.01% 92 2006 0.01% 93 2425 0.01% 94 3111 0.02% 95 6142 0.03% 96 27830 0.15% 97 91791 0.51% 98 351812 1.95% 99 1226143 6.79% 100 4266306 23.61% 101 12057387 66.72% 18070940 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.16 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=163.82 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=21.7 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:07:56 Started mapping on | Dec 06 15:07:56 Finished on | Dec 06 15:08:19 Mapping speed, Million of reads per hour | 2828.49 Number of input reads | 18070940 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17159764 Uniquely mapped reads % | 94.96% Average mapped length | 100.16 Number of splices: Total | 6736661 Number of splices: Annotated (sjdb) | 6424957 Number of splices: GT/AG | 6643198 Number of splices: GC/AG | 80878 Number of splices: AT/AC | 3989 Number of splices: Non-canonical | 8596 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452147 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 200871 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 459029 459029 459029 N_multimapping 452147 452147 452147 N_noFeature 760201 8913604 8782462 N_ambiguous 259377 19088 18456 UnstrandedReadsAssigned:16140186 PositiveStrandReadsAssigned:8227072 NegativeStrandReadsAssigned:8358846 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853451 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853451-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,070,940 reads, 16,584,260 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR21853451.ke.tsv 35125 SRR21853451.se.tsv 88098 total ==> SRR21853451.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.850114 0.10936 PNS24247 1044 945 48.0818 5.47842 PNS24249 1928 1829 106.811 6.28793 PNS24246 1044 945 48.0818 5.47842 PNS24248 1044 945 48.0818 5.47842 PNS24244 1471 1372 47.094 3.69588 PNS24243 293 194 4 2.22006 KQK14069 1603 1504 1829.06 130.944 KQK14071 474 375 268.821 77.1859 ==> SRR21853451.se.tsv <== BRADI_1g14170v3 2345 BRADI_1g53295v3 88 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 103 BRADI_1g20270v3 2007 BRADI_1g74790v3 138 BRADI_1g09890v3 3 BRADI_1g77505v3 306 BRADI_1g48960v3 0 SRR21853451 completed mapping pipeline successfully