Starting /dee2/code/volunteer_pipeline.sh SRR21853452 current disk space = 1550483103744 free memory = 1600466600 SRR21853452 SRAfilesize 98048d0531e588ace71f523e6885dec6 SRR21853452.sra SRR21853452.sra file validated SRR21853452 is single end SRR21853452 is conventional basespace SRR21853452 read1 length is 83-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 83-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.288 37.0 37.0 37.0 37.0 37.0 2 35.7935 37.0 37.0 37.0 37.0 37.0 3 35.905 37.0 37.0 37.0 37.0 37.0 4 35.8735 37.0 37.0 37.0 37.0 37.0 5 35.9715 37.0 37.0 37.0 37.0 37.0 6 36.038 37.0 37.0 37.0 37.0 37.0 7 35.905 37.0 37.0 37.0 37.0 37.0 8 35.951 37.0 37.0 37.0 37.0 37.0 9 36.037 37.0 37.0 37.0 37.0 37.0 10-11 36.113 37.0 37.0 37.0 37.0 37.0 12-13 36.036 37.0 37.0 37.0 37.0 37.0 14-15 35.88825 37.0 37.0 37.0 37.0 37.0 16-17 35.8425 37.0 37.0 37.0 37.0 37.0 18-19 35.9545 37.0 37.0 37.0 37.0 37.0 20-21 35.8575 37.0 37.0 37.0 37.0 37.0 22-23 35.84075 37.0 37.0 37.0 37.0 37.0 24-25 35.87325 37.0 37.0 37.0 37.0 37.0 26-27 35.8185 37.0 37.0 37.0 37.0 37.0 28-29 35.7755 37.0 37.0 37.0 37.0 37.0 30-31 35.73675 37.0 37.0 37.0 37.0 37.0 32-33 35.732 37.0 37.0 37.0 37.0 37.0 34-35 35.7205 37.0 37.0 37.0 37.0 37.0 36-37 35.7775 37.0 37.0 37.0 37.0 37.0 38-39 35.823 37.0 37.0 37.0 37.0 37.0 40-41 35.726 37.0 37.0 37.0 37.0 37.0 42-43 35.71025 37.0 37.0 37.0 37.0 37.0 44-45 35.70675 37.0 37.0 37.0 37.0 37.0 46-47 35.7855 37.0 37.0 37.0 37.0 37.0 48-49 35.626000000000005 37.0 37.0 37.0 37.0 37.0 50-51 35.646 37.0 37.0 37.0 37.0 37.0 52-53 35.548500000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.713750000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.556250000000006 37.0 37.0 37.0 37.0 37.0 58-59 35.69175 37.0 37.0 37.0 37.0 37.0 60-61 35.66225 37.0 37.0 37.0 37.0 37.0 62-63 35.60225 37.0 37.0 37.0 37.0 37.0 64-65 35.60975 37.0 37.0 37.0 37.0 37.0 66-67 35.622 37.0 37.0 37.0 37.0 37.0 68-69 35.54175 37.0 37.0 37.0 37.0 37.0 70-71 35.644000000000005 37.0 37.0 37.0 37.0 37.0 72-73 35.55525 37.0 37.0 37.0 37.0 37.0 74-75 35.58175 37.0 37.0 37.0 37.0 37.0 76-77 35.5565 37.0 37.0 37.0 37.0 37.0 78-79 35.53975 37.0 37.0 37.0 37.0 37.0 80-81 35.47775 37.0 37.0 37.0 37.0 37.0 82-83 35.612750000000005 37.0 37.0 37.0 37.0 37.0 84-85 35.57021634097869 37.0 37.0 37.0 37.0 37.0 86-87 35.48649324662331 37.0 37.0 37.0 37.0 37.0 88-89 35.42871435717859 37.0 37.0 37.0 37.0 37.0 90-91 35.5887943971986 37.0 37.0 37.0 37.0 37.0 92-93 35.59769827370528 37.0 37.0 37.0 37.0 37.0 94-95 35.495689021520896 37.0 37.0 37.0 37.0 37.0 96-97 35.49277245842839 37.0 37.0 37.0 37.0 37.0 98-99 35.40332892135431 37.0 37.0 37.0 37.0 37.0 100-101 35.13807961271664 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 2.0 24 7.0 25 6.0 26 13.0 27 16.0 28 25.0 29 42.0 30 72.0 31 81.0 32 120.0 33 173.0 34 241.0 35 491.0 36 2179.0 37 530.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.25 12.825000000000001 16.650000000000002 41.275 2 26.875 19.375 30.0 23.75 3 26.325 23.1 23.025000000000002 27.55 4 26.6 30.075000000000003 17.224999999999998 26.1 5 27.650000000000002 30.925000000000004 20.45 20.974999999999998 6 22.475 33.025 20.925 23.575 7 20.525 15.675 37.85 25.95 8 23.5 20.575 26.075 29.849999999999998 9 20.525 19.875 28.65 30.95 10-11 25.624999999999996 26.987499999999997 20.0125 27.375 12-13 24.587500000000002 21.8125 25.624999999999996 27.975 14-15 24.3 24.6125 23.275000000000002 27.8125 16-17 25.937500000000004 23.9125 23.0625 27.0875 18-19 25.3 25.0625 23.6625 25.974999999999998 20-21 26.137500000000003 24.2 23.9 25.7625 22-23 25.2 24.337500000000002 24.1625 26.3 24-25 25.025 23.7625 24.212500000000002 27.0 26-27 24.9125 24.675 23.3375 27.075 28-29 24.6625 24.3125 23.799999999999997 27.224999999999998 30-31 24.462500000000002 24.962500000000002 23.7875 26.787499999999998 32-33 25.724999999999998 24.4875 23.5125 26.275 34-35 25.4375 24.55 23.474999999999998 26.5375 36-37 26.187500000000004 24.15 22.650000000000002 27.0125 38-39 24.95 25.25 23.7125 26.087500000000002 40-41 25.8125 23.9 23.6125 26.674999999999997 42-43 24.575 23.9125 24.7375 26.775 44-45 25.6125 23.8875 24.05 26.450000000000003 46-47 25.5375 25.0375 22.3 27.125 48-49 24.125 24.925 24.15 26.8 50-51 25.924999999999997 23.425 23.7 26.950000000000003 52-53 24.837500000000002 24.337500000000002 23.5875 27.237499999999997 54-55 26.2125 23.5875 23.974999999999998 26.224999999999998 56-57 25.7875 23.8375 23.200000000000003 27.175 58-59 25.4625 23.8875 24.224999999999998 26.424999999999997 60-61 25.15 23.1375 24.4875 27.224999999999998 62-63 26.337500000000002 23.9125 23.125 26.625 64-65 25.3125 24.099999999999998 23.2625 27.325 66-67 24.6125 23.2625 25.5125 26.6125 68-69 25.45 25.25 23.0375 26.2625 70-71 25.575 24.2875 23.3125 26.825 72-73 26.4125 24.0625 23.175 26.35 74-75 25.5125 23.400000000000002 23.2875 27.800000000000004 76-77 26.424999999999997 23.8125 23.1375 26.625 78-79 25.374999999999996 23.925 23.775 26.924999999999997 80-81 25.5125 24.087500000000002 23.4875 26.9125 82-83 25.3125 24.6 23.3875 26.700000000000003 84-85 25.447042640990368 23.6963861448043 23.42128298111792 27.435288233087405 86-87 25.587793896948476 24.112056028014006 23.3991995997999 26.900950475237618 88-89 26.088044022011005 24.099549774887443 23.274137068534266 26.538269134567283 90-91 25.67533766883442 24.399699849924964 23.486743371685844 26.43821910955478 92-93 26.682511883912934 24.630973229922443 22.254190642982234 26.432324243182386 94-95 26.423120230201423 24.121105967721757 23.570624296259226 25.88514950581759 96-97 25.814128256513026 23.872745490981963 23.321643286573146 26.991482965931862 98-99 26.701503951057866 22.97986235024216 24.356359928626052 25.962273770073924 100-101 27.73676770849694 10.570127218470237 28.851892571069577 32.84121250196325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.0 28 3.5 29 7.0 30 8.5 31 8.5 32 8.0 33 13.0 34 19.0 35 24.0 36 36.5 37 51.0 38 56.0 39 86.5 40 98.0 41 105.5 42 129.0 43 136.5 44 148.5 45 156.5 46 165.0 47 166.0 48 160.0 49 146.0 50 150.5 51 156.0 52 139.0 53 131.0 54 126.0 55 114.5 56 114.0 57 105.0 58 96.5 59 94.5 60 86.5 61 79.0 62 70.5 63 66.0 64 72.5 65 80.5 66 80.5 67 72.5 68 57.0 69 52.5 70 51.0 71 42.5 72 38.0 73 38.0 74 35.5 75 33.5 76 26.5 77 23.0 78 16.5 79 7.0 80 4.0 81 1.5 82 2.0 83 1.5 84 2.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 1.0 95 1.0 96 6.0 97 27.0 98 78.0 99 264.0 100 873.0 101 2747.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.26355340848094 86.875 2 6.199677938808374 11.55 3 0.4830917874396135 1.35 4 0.026838432635534086 0.1 5 0.026838432635534086 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434650 spots for SRR21853452.sra Written 434650 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra Read 434634 spots for SRR21853452.sra Written 434634 spots for SRR21853452.sra SRR ids: ['SRR21853452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rvm8bpuw SRR21853452.sra spots: 8692696 blocks: [[1, 434634], [434635, 869268], [869269, 1303902], [1303903, 1738536], [1738537, 2173170], [2173171, 2607804], [2607805, 3042438], [3042439, 3477072], [3477073, 3911706], [3911707, 4346340], [4346341, 4780974], [4780975, 5215608], [5215609, 5650242], [5650243, 6084876], [6084877, 6519510], [6519511, 6954144], [6954145, 7388778], [7388779, 7823412], [7823413, 8258046], [8258047, 8692696]] SRR21853452 file size 2337424 SRR21853452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853452 SRR21853452_1.fastq Input file: SRR21853452_1.fastq trimmed: SRR21853452-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:08:01 2024 >> started Fri Dec 6 15:08:09 2024 >> done (8.356s) 8692696 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 22829 ( 0.26%) empty reads filtered out after trimming by size control 8669863 (99.74%) reads available; of these: 316 ( 0.00%) trimmed reads available after processing 8669547 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 1 0.00% 31 3 0.00% 32 7 0.00% 33 7 0.00% 34 2 0.00% 35 20 0.00% 36 11 0.00% 37 18 0.00% 38 19 0.00% 39 18 0.00% 40 20 0.00% 41 19 0.00% 42 20 0.00% 43 22 0.00% 44 15 0.00% 45 25 0.00% 46 29 0.00% 47 32 0.00% 48 20 0.00% 49 18 0.00% 50 25 0.00% 51 26 0.00% 52 22 0.00% 53 25 0.00% 54 27 0.00% 55 22 0.00% 56 26 0.00% 57 27 0.00% 58 37 0.00% 59 38 0.00% 60 42 0.00% 61 28 0.00% 62 32 0.00% 63 31 0.00% 64 30 0.00% 65 36 0.00% 66 44 0.00% 67 34 0.00% 68 30 0.00% 69 26 0.00% 70 33 0.00% 71 42 0.00% 72 49 0.00% 73 45 0.00% 74 42 0.00% 75 56 0.00% 76 42 0.00% 77 53 0.00% 78 43 0.00% 79 42 0.00% 80 49 0.00% 81 70 0.00% 82 63 0.00% 83 64 0.00% 84 83 0.00% 85 79 0.00% 86 72 0.00% 87 94 0.00% 88 96 0.00% 89 117 0.00% 90 118 0.00% 91 420 0.00% 92 141 0.00% 93 226 0.00% 94 513 0.01% 95 1972 0.02% 96 11431 0.13% 97 38817 0.45% 98 151402 1.75% 99 577226 6.66% 100 1935348 22.32% 101 5950071 68.63% 8669863 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=13 prefix-density=0.48 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=190.73 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=23.5 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:08:25 Started mapping on | Dec 06 15:08:26 Finished on | Dec 06 15:08:43 Mapping speed, Million of reads per hour | 1835.97 Number of input reads | 8669863 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7830206 Uniquely mapped reads % | 90.32% Average mapped length | 100.27 Number of splices: Total | 2801881 Number of splices: Annotated (sjdb) | 2664908 Number of splices: GT/AG | 2763241 Number of splices: GC/AG | 33159 Number of splices: AT/AC | 1542 Number of splices: Non-canonical | 3939 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386523 % of reads mapped to multiple loci | 4.46% Number of reads mapped to too many loci | 321482 % of reads mapped to too many loci | 3.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.00% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 453134 453134 453134 N_multimapping 386523 386523 386523 N_noFeature 286481 4072392 3941985 N_ambiguous 118297 8755 8176 UnstrandedReadsAssigned:7425428 PositiveStrandReadsAssigned:3749059 NegativeStrandReadsAssigned:3880045 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853452 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853452-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,669,863 reads, 7,700,176 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52973 SRR21853452.ke.tsv 35125 SRR21853452.se.tsv 88098 total ==> SRR21853452.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 21.4465 4.9031 PNS24249 1928 1829 87.6604 10.3546 PNS24246 1044 945 21.4465 4.9031 PNS24248 1044 945 21.4465 4.9031 PNS24244 1471 1372 0 0 PNS24243 293 194 1 1.11364 KQK14069 1603 1504 1514.59 217.566 KQK14071 474 375 118.462 68.2482 ==> SRR21853452.se.tsv <== BRADI_1g14170v3 1706 BRADI_1g53295v3 42 BRADI_1g59795v3 98 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 876 BRADI_1g74790v3 109 BRADI_1g09890v3 1 BRADI_1g77505v3 99 BRADI_1g48960v3 0 SRR21853452 completed mapping pipeline successfully