Starting /dee2/code/volunteer_pipeline.sh SRR21853453 current disk space = 1550388047872 free memory = 1599835800 SRR21853453 SRAfilesize 2a9a5ddf52301025f9815dc94123a6a4 SRR21853453.sra SRR21853453.sra file validated SRR21853453 is single end SRR21853453 is conventional basespace SRR21853453 read1 length is 66-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 66-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0115 37.0 37.0 37.0 25.0 37.0 2 34.6995 37.0 37.0 37.0 25.0 37.0 3 35.5115 37.0 37.0 37.0 37.0 37.0 4 35.57 37.0 37.0 37.0 37.0 37.0 5 35.7065 37.0 37.0 37.0 37.0 37.0 6 35.6005 37.0 37.0 37.0 37.0 37.0 7 35.6925 37.0 37.0 37.0 37.0 37.0 8 35.773 37.0 37.0 37.0 37.0 37.0 9 35.696 37.0 37.0 37.0 37.0 37.0 10-11 35.88175 37.0 37.0 37.0 37.0 37.0 12-13 35.689750000000004 37.0 37.0 37.0 37.0 37.0 14-15 35.8035 37.0 37.0 37.0 37.0 37.0 16-17 35.603 37.0 37.0 37.0 37.0 37.0 18-19 35.7305 37.0 37.0 37.0 37.0 37.0 20-21 35.63875 37.0 37.0 37.0 37.0 37.0 22-23 35.60525 37.0 37.0 37.0 37.0 37.0 24-25 35.643 37.0 37.0 37.0 37.0 37.0 26-27 35.480999999999995 37.0 37.0 37.0 37.0 37.0 28-29 35.5295 37.0 37.0 37.0 37.0 37.0 30-31 35.445499999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.502250000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.3995 37.0 37.0 37.0 37.0 37.0 36-37 35.4305 37.0 37.0 37.0 37.0 37.0 38-39 35.3815 37.0 37.0 37.0 37.0 37.0 40-41 35.55875 37.0 37.0 37.0 37.0 37.0 42-43 35.4035 37.0 37.0 37.0 37.0 37.0 44-45 35.37125 37.0 37.0 37.0 37.0 37.0 46-47 35.370000000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.32899999999999 37.0 37.0 37.0 31.0 37.0 50-51 35.397 37.0 37.0 37.0 37.0 37.0 52-53 35.43875 37.0 37.0 37.0 37.0 37.0 54-55 35.282 37.0 37.0 37.0 31.0 37.0 56-57 35.30625 37.0 37.0 37.0 31.0 37.0 58-59 35.24125 37.0 37.0 37.0 31.0 37.0 60-61 35.27275 37.0 37.0 37.0 31.0 37.0 62-63 35.22175 37.0 37.0 37.0 31.0 37.0 64-65 35.303 37.0 37.0 37.0 31.0 37.0 66-67 35.28777369342336 37.0 37.0 37.0 31.0 37.0 68-69 35.15378844711178 37.0 37.0 37.0 25.0 37.0 70-71 35.17979494873718 37.0 37.0 37.0 25.0 37.0 72-73 35.26156539134784 37.0 37.0 37.0 31.0 37.0 74-75 35.18404601150287 37.0 37.0 37.0 25.0 37.0 76-77 35.19479869967492 37.0 37.0 37.0 25.0 37.0 78-79 35.168042010502624 37.0 37.0 37.0 25.0 37.0 80-81 35.16829207301825 37.0 37.0 37.0 31.0 37.0 82-83 35.230807701925485 37.0 37.0 37.0 25.0 37.0 84-85 35.0960240060015 37.0 37.0 37.0 25.0 37.0 86-87 35.170292573143286 37.0 37.0 37.0 25.0 37.0 88-89 35.24211694654962 37.0 37.0 37.0 31.0 37.0 90-91 35.04578433825369 37.0 37.0 37.0 25.0 37.0 92-93 35.123873873873876 37.0 37.0 37.0 25.0 37.0 94-95 35.14618272841051 37.0 37.0 37.0 25.0 37.0 96-97 35.017548264317355 37.0 37.0 37.0 25.0 37.0 98-99 35.08055376434205 37.0 37.0 37.0 25.0 37.0 100-101 34.911337696059796 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 4.0 24 6.0 25 11.0 26 14.0 27 21.0 28 37.0 29 56.0 30 85.0 31 115.0 32 149.0 33 243.0 34 320.0 35 580.0 36 2009.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.875 12.325 16.650000000000002 41.15 2 26.68525088697415 19.766852508869743 29.574252407501266 23.97364419665484 3 24.75 23.525 22.95 28.775000000000002 4 27.775 27.950000000000003 18.4 25.874999999999996 5 27.650000000000002 29.9 20.025000000000002 22.425 6 22.35 32.125 20.925 24.6 7 19.925 16.6 38.65 24.825 8 23.825 21.725 23.575 30.875000000000004 9 22.55 21.0 26.375 30.075000000000003 10-11 26.437500000000004 27.325 20.2875 25.95 12-13 24.4875 23.25 25.087500000000002 27.175 14-15 24.6875 23.799999999999997 24.1875 27.325 16-17 25.0375 24.462500000000002 23.3625 27.1375 18-19 25.05 23.775 23.65 27.525 20-21 26.474999999999998 23.974999999999998 23.425 26.125 22-23 23.8125 24.875 23.875 27.437499999999996 24-25 25.2 24.4125 23.2375 27.150000000000002 26-27 25.35 25.337500000000002 23.25 26.0625 28-29 25.624999999999996 24.5125 23.1625 26.700000000000003 30-31 23.7875 24.637500000000003 24.3125 27.2625 32-33 25.25 24.962500000000002 24.05 25.7375 34-35 24.1125 25.25 23.75 26.887499999999996 36-37 24.975 24.5125 23.925 26.5875 38-39 25.912499999999998 23.5625 23.575 26.950000000000003 40-41 25.7375 24.575 23.9375 25.75 42-43 25.25 24.4125 23.575 26.7625 44-45 25.374999999999996 24.5 23.974999999999998 26.150000000000002 46-47 25.5625 23.7125 24.4375 26.2875 48-49 24.9875 24.8125 24.349999999999998 25.85 50-51 26.5625 24.825 23.325000000000003 25.2875 52-53 25.4625 24.825 23.175 26.5375 54-55 24.5375 24.8625 24.125 26.474999999999998 56-57 24.4375 24.325 23.875 27.3625 58-59 25.362499999999997 24.6875 23.775 26.174999999999997 60-61 26.075 23.9125 24.3125 25.7 62-63 26.5 22.95 24.05 26.5 64-65 25.337500000000002 24.0 24.9 25.7625 66-67 26.328291036379547 24.00300037504688 23.32791598949869 26.340792599074884 68-69 24.88122030507627 24.23105776444111 23.80595148787197 27.081770442610654 70-71 26.25656414103526 24.418604651162788 23.23080770192548 26.094023505876468 72-73 25.756439109777446 23.730932733183295 23.893473368342086 26.619154788697173 74-75 25.76894223555889 24.131032758189548 23.593398349587396 26.506626656664167 76-77 27.481870467616904 23.93098274568642 22.818204551137786 25.76894223555889 78-79 25.63140785196299 23.768442110527634 24.20605151287822 26.39409852463116 80-81 25.63140785196299 24.48112028007002 23.88097024256064 26.006501625406354 82-83 26.6816704176044 23.093273318329583 22.980745186296573 27.24431107776944 84-85 25.51887971992998 23.730932733183295 24.118529632408105 26.63165791447862 86-87 25.85646411602901 24.793698424606152 23.40585146286572 25.943985996499126 88-89 26.675837918959477 23.961980990495245 23.59929964982491 25.76288144072036 90-91 25.806855141356017 23.617713284963724 24.74355766825119 25.83187390542907 92-93 25.900900900900904 24.21171171171171 23.836336336336338 26.05105105105105 94-95 26.958698372966204 23.541927409261575 23.591989987484354 25.90738423028786 96-97 25.804835274959288 23.8757359388701 24.251534510835526 26.067894275335085 98-99 25.715739916019846 23.450820715103703 23.679857488230056 27.153581880646392 100-101 27.66057934508816 10.70528967254408 28.982997481108313 32.651133501259444 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 3.0 26 3.0 27 2.5 28 3.0 29 5.0 30 7.5 31 7.0 32 11.5 33 16.0 34 21.5 35 26.0 36 36.0 37 52.0 38 57.5 39 79.0 40 99.5 41 117.0 42 140.0 43 150.5 44 136.0 45 136.5 46 181.5 47 180.0 48 147.0 49 144.5 50 156.5 51 150.0 52 132.0 53 121.5 54 121.0 55 128.5 56 124.5 57 108.0 58 92.0 59 99.5 60 96.5 61 74.0 62 72.5 63 68.5 64 58.5 65 65.5 66 67.0 67 67.0 68 58.0 69 56.0 70 60.5 71 47.0 72 37.5 73 33.0 74 29.5 75 21.5 76 16.5 77 17.5 78 17.0 79 16.0 80 11.5 81 5.5 82 3.5 83 3.0 84 1.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.35 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 2.0 89 0.0 90 0.0 91 1.0 92 0.0 93 1.0 94 0.0 95 0.0 96 7.0 97 21.0 98 75.0 99 272.0 100 888.0 101 2732.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.65042372881356 89.35 2 5.031779661016949 9.5 3 0.26483050847457623 0.75 4 0.0 0.0 5 0.0 0.0 6 0.026483050847457626 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026483050847457626 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 10 0.25 TruSeq Adapter, Index 3 (97% over 36bp) CCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAAGTCGAAC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812610 spots for SRR21853453.sra Written 812610 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra Read 812598 spots for SRR21853453.sra Written 812598 spots for SRR21853453.sra SRR ids: ['SRR21853453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sstiv1pq SRR21853453.sra spots: 16251972 blocks: [[1, 812598], [812599, 1625196], [1625197, 2437794], [2437795, 3250392], [3250393, 4062990], [4062991, 4875588], [4875589, 5688186], [5688187, 6500784], [6500785, 7313382], [7313383, 8125980], [8125981, 8938578], [8938579, 9751176], [9751177, 10563774], [10563775, 11376372], [11376373, 12188970], [12188971, 13001568], [13001569, 13814166], [13814167, 14626764], [14626765, 15439362], [15439363, 16251972]] SRR21853453 file size 4376650 SRR21853453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853453 SRR21853453_1.fastq Input file: SRR21853453_1.fastq trimmed: SRR21853453-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:11:19 2024 >> started Fri Dec 6 15:11:28 2024 >> done (9.441s) 16251972 reads processed; of these: 18 ( 0.00%) short reads filtered out after trimming by size control 73531 ( 0.45%) empty reads filtered out after trimming by size control 16178423 (99.55%) reads available; of these: 358 ( 0.00%) trimmed reads available after processing 16178065 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 2 0.00% 25 1 0.00% 26 8 0.00% 27 2 0.00% 28 5 0.00% 29 8 0.00% 30 3 0.00% 31 4 0.00% 32 4 0.00% 33 6 0.00% 34 4 0.00% 35 72 0.00% 36 97 0.00% 37 90 0.00% 38 80 0.00% 39 69 0.00% 40 88 0.00% 41 97 0.00% 42 81 0.00% 43 83 0.00% 44 94 0.00% 45 85 0.00% 46 91 0.00% 47 103 0.00% 48 88 0.00% 49 107 0.00% 50 104 0.00% 51 105 0.00% 52 95 0.00% 53 103 0.00% 54 112 0.00% 55 118 0.00% 56 119 0.00% 57 112 0.00% 58 143 0.00% 59 156 0.00% 60 125 0.00% 61 129 0.00% 62 145 0.00% 63 150 0.00% 64 137 0.00% 65 158 0.00% 66 184 0.00% 67 154 0.00% 68 160 0.00% 69 154 0.00% 70 173 0.00% 71 175 0.00% 72 184 0.00% 73 157 0.00% 74 173 0.00% 75 163 0.00% 76 182 0.00% 77 196 0.00% 78 211 0.00% 79 227 0.00% 80 232 0.00% 81 238 0.00% 82 206 0.00% 83 244 0.00% 84 252 0.00% 85 288 0.00% 86 285 0.00% 87 328 0.00% 88 319 0.00% 89 370 0.00% 90 398 0.00% 91 997 0.01% 92 469 0.00% 93 562 0.00% 94 1208 0.01% 95 3827 0.02% 96 21601 0.13% 97 73322 0.45% 98 285400 1.76% 99 1082208 6.69% 100 3621816 22.39% 101 11077969 68.47% 16178423 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=10 prefix-density=0.48 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=13.35 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=2.5 sequence=GCTGCTGGCACCAGACTTGCCCTCCAATGGATCCTCGTTAAGGGATTTAGATTGTACTCATTCCAATTACCAGACACTAATGTGCCCGGTATTGTTATTTATTGTCACTACCTCCCCGTGTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCGTTTCTCAGGCTCCCTCTCCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCCCTATCCTACCATCGAAAGTTGATAGGGCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTCGAGTTATCATGAATCAT Started job on | Dec 06 15:11:45 Started mapping on | Dec 06 15:11:45 Finished on | Dec 06 15:12:11 Mapping speed, Million of reads per hour | 2240.09 Number of input reads | 16178423 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14598187 Uniquely mapped reads % | 90.23% Average mapped length | 100.24 Number of splices: Total | 5268637 Number of splices: Annotated (sjdb) | 5011675 Number of splices: GT/AG | 5195206 Number of splices: GC/AG | 62768 Number of splices: AT/AC | 2731 Number of splices: Non-canonical | 7932 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 718296 % of reads mapped to multiple loci | 4.44% Number of reads mapped to too many loci | 579093 % of reads mapped to too many loci | 3.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.23% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861940 861940 861940 N_multimapping 718296 718296 718296 N_noFeature 533536 7571275 7368156 N_ambiguous 221711 16036 15119 UnstrandedReadsAssigned:13842940 PositiveStrandReadsAssigned:7010876 NegativeStrandReadsAssigned:7214912 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853453 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853453-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,178,423 reads, 14,344,575 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR21853453.ke.tsv 35125 SRR21853453.se.tsv 88098 total ==> SRR21853453.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 76.4045 10.5399 PNS24247 1044 945 32.2193 3.93666 PNS24249 1928 1829 144.506 9.12256 PNS24246 1044 945 32.2193 3.93666 PNS24248 1044 945 32.2193 3.93666 PNS24244 1471 1372 19.4312 1.63527 PNS24243 293 194 8 4.76137 KQK14069 1603 1504 2825.21 216.893 KQK14071 474 375 284.653 87.645 ==> SRR21853453.se.tsv <== BRADI_1g14170v3 3441 BRADI_1g53295v3 68 BRADI_1g59795v3 202 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 1568 BRADI_1g74790v3 174 BRADI_1g09890v3 8 BRADI_1g77505v3 187 BRADI_1g48960v3 0 SRR21853453 completed mapping pipeline successfully