Starting /dee2/code/volunteer_pipeline.sh SRR21853454 current disk space = 1550366400512 free memory = 1598343392 SRR21853454 SRAfilesize a2529a09842ae419ad2f0878a012bed3 SRR21853454.sra SRR21853454.sra file validated SRR21853454 is single end SRR21853454 is conventional basespace SRR21853454 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.527 37.0 37.0 37.0 37.0 37.0 2 35.6065 37.0 37.0 37.0 37.0 37.0 3 35.767 37.0 37.0 37.0 37.0 37.0 4 35.8895 37.0 37.0 37.0 37.0 37.0 5 35.94 37.0 37.0 37.0 37.0 37.0 6 36.0425 37.0 37.0 37.0 37.0 37.0 7 35.9105 37.0 37.0 37.0 37.0 37.0 8 35.9145 37.0 37.0 37.0 37.0 37.0 9 35.8605 37.0 37.0 37.0 37.0 37.0 10-11 36.038 37.0 37.0 37.0 37.0 37.0 12-13 35.9085 37.0 37.0 37.0 37.0 37.0 14-15 35.9705 37.0 37.0 37.0 37.0 37.0 16-17 35.877750000000006 37.0 37.0 37.0 37.0 37.0 18-19 35.92575 37.0 37.0 37.0 37.0 37.0 20-21 35.79075 37.0 37.0 37.0 37.0 37.0 22-23 35.88775 37.0 37.0 37.0 37.0 37.0 24-25 35.90475 37.0 37.0 37.0 37.0 37.0 26-27 35.69925 37.0 37.0 37.0 37.0 37.0 28-29 35.631249999999994 37.0 37.0 37.0 37.0 37.0 30-31 35.62775 37.0 37.0 37.0 37.0 37.0 32-33 35.6575 37.0 37.0 37.0 37.0 37.0 34-35 35.6165 37.0 37.0 37.0 37.0 37.0 36-37 35.711 37.0 37.0 37.0 37.0 37.0 38-39 35.7285 37.0 37.0 37.0 37.0 37.0 40-41 35.76925 37.0 37.0 37.0 37.0 37.0 42-43 35.729749999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.727500000000006 37.0 37.0 37.0 37.0 37.0 46-47 35.8465 37.0 37.0 37.0 37.0 37.0 48-49 35.667500000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.588 37.0 37.0 37.0 37.0 37.0 52-53 35.671499999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.611 37.0 37.0 37.0 37.0 37.0 56-57 35.6275 37.0 37.0 37.0 37.0 37.0 58-59 35.55475 37.0 37.0 37.0 37.0 37.0 60-61 35.611000000000004 37.0 37.0 37.0 37.0 37.0 62-63 35.558499999999995 37.0 37.0 37.0 37.0 37.0 64-65 35.6265 37.0 37.0 37.0 37.0 37.0 66-67 35.63425 37.0 37.0 37.0 37.0 37.0 68-69 35.47925 37.0 37.0 37.0 37.0 37.0 70-71 35.63525 37.0 37.0 37.0 37.0 37.0 72-73 35.583 37.0 37.0 37.0 37.0 37.0 74-75 35.51575 37.0 37.0 37.0 37.0 37.0 76-77 35.473 37.0 37.0 37.0 37.0 37.0 78-79 35.51975 37.0 37.0 37.0 37.0 37.0 80-81 35.493 37.0 37.0 37.0 37.0 37.0 82-83 35.59075 37.0 37.0 37.0 37.0 37.0 84-85 35.655249999999995 37.0 37.0 37.0 37.0 37.0 86-87 35.61775 37.0 37.0 37.0 37.0 37.0 88-89 35.54875 37.0 37.0 37.0 37.0 37.0 90-91 35.43475 37.0 37.0 37.0 37.0 37.0 92-93 35.446 37.0 37.0 37.0 37.0 37.0 94-95 35.476749999999996 37.0 37.0 37.0 37.0 37.0 96-97 35.568282700608634 37.0 37.0 37.0 37.0 37.0 98-99 35.28636862241209 37.0 37.0 37.0 37.0 37.0 100-101 35.26541953650267 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 8.0 24 5.0 25 8.0 26 16.0 27 22.0 28 28.0 29 41.0 30 48.0 31 99.0 32 101.0 33 172.0 34 265.0 35 484.0 36 2210.0 37 492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.474999999999998 13.375 19.075 40.075 2 23.775 20.625 32.25 23.35 3 26.025 23.849999999999998 24.825 25.3 4 28.15 27.35 19.775000000000002 24.725 5 27.700000000000003 31.15 20.7 20.45 6 22.325 34.675 21.4 21.6 7 19.8 17.8 40.550000000000004 21.85 8 22.7 22.425 26.1 28.775000000000002 9 21.55 22.0 28.825 27.625 10-11 24.4875 30.049999999999997 21.1875 24.275 12-13 23.724999999999998 23.724999999999998 26.650000000000002 25.900000000000002 14-15 22.7125 25.424999999999997 26.8375 25.025 16-17 23.5625 25.674999999999997 25.6 25.162499999999998 18-19 23.150000000000002 26.700000000000003 25.137500000000003 25.0125 20-21 24.5 25.825 25.324999999999996 24.349999999999998 22-23 24.099999999999998 26.4125 25.4 24.087500000000002 24-25 24.0625 26.450000000000003 25.6 23.8875 26-27 23.175 25.6125 25.074999999999996 26.137500000000003 28-29 22.6875 26.137500000000003 25.2375 25.937500000000004 30-31 23.825 26.400000000000002 25.75 24.025 32-33 22.475 26.3 25.55 25.674999999999997 34-35 22.55 26.137500000000003 26.1125 25.2 36-37 23.0 26.337500000000002 26.525 24.1375 38-39 23.6125 25.0 26.437500000000004 24.95 40-41 24.1875 25.587500000000002 26.1 24.125 42-43 24.0 25.362499999999997 26.075 24.5625 44-45 23.9875 25.8125 25.35 24.85 46-47 24.425 26.5125 24.9125 24.15 48-49 23.325000000000003 26.075 26.087500000000002 24.5125 50-51 23.474999999999998 26.1125 25.124999999999996 25.2875 52-53 24.325 25.6125 25.6125 24.45 54-55 23.7375 26.087500000000002 25.5 24.675 56-57 23.325000000000003 25.95 25.3 25.424999999999997 58-59 23.9 25.624999999999996 25.887500000000003 24.587500000000002 60-61 23.8875 25.224999999999998 25.9625 24.925 62-63 24.3875 25.8625 25.900000000000002 23.849999999999998 64-65 23.225 26.950000000000003 24.675 25.15 66-67 23.200000000000003 26.2125 25.6125 24.975 68-69 25.137500000000003 25.387500000000003 25.4625 24.0125 70-71 24.337500000000002 26.237500000000004 25.474999999999998 23.95 72-73 23.962500000000002 25.637500000000003 24.6125 25.7875 74-75 23.6375 26.35 25.7375 24.275 76-77 23.525 26.2625 25.9875 24.224999999999998 78-79 23.775 25.837500000000002 25.637500000000003 24.75 80-81 24.5125 25.7625 25.7375 23.9875 82-83 24.45 25.1 25.912499999999998 24.5375 84-85 24.4375 26.400000000000002 25.424999999999997 23.7375 86-87 25.2375 25.0 25.5125 24.25 88-89 24.6 25.124999999999996 24.9 25.374999999999996 90-91 23.7375 25.624999999999996 26.025 24.6125 92-93 24.212500000000002 26.474999999999998 24.087500000000002 25.224999999999998 94-95 24.4375 26.224999999999998 24.962500000000002 24.375 96-97 23.6199774690199 25.37238703216923 26.33621229190136 24.671423206909502 98-99 24.479166666666664 24.58079268292683 25.73678861788618 25.203252032520325 100-101 26.061470215462613 11.771229404309253 31.020278833967048 31.14702154626109 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 1.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 3.5 25 4.0 26 2.0 27 4.5 28 7.5 29 7.5 30 8.5 31 14.0 32 18.5 33 23.0 34 27.0 35 36.0 36 50.5 37 71.5 38 89.5 39 99.0 40 120.5 41 141.0 42 170.5 43 203.5 44 224.5 45 219.5 46 199.5 47 197.5 48 191.5 49 177.0 50 161.0 51 147.5 52 127.5 53 121.0 54 117.0 55 95.5 56 95.5 57 93.5 58 75.5 59 60.5 60 55.0 61 51.5 62 48.0 63 47.0 64 39.5 65 41.0 66 43.0 67 39.5 68 36.5 69 32.0 70 28.0 71 22.5 72 21.5 73 23.0 74 18.5 75 13.0 76 8.5 77 5.5 78 5.5 79 3.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 2.0 96 7.0 97 15.0 98 80.0 99 276.0 100 928.0 101 2692.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.875 #Duplication Level Percentage of deduplicated Percentage of total 1 95.23056653491436 90.35 2 4.453227931488801 8.450000000000001 3 0.21080368906455862 0.6 4 0.026350461133069828 0.1 5 0.026350461133069828 0.125 6 0.026350461133069828 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026350461133069828 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCGCGTAT 5 0.125 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067488 spots for SRR21853454.sra Written 1067488 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra Read 1067482 spots for SRR21853454.sra Written 1067482 spots for SRR21853454.sra SRR ids: ['SRR21853454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ajq0xon SRR21853454.sra spots: 21349646 blocks: [[1, 1067482], [1067483, 2134964], [2134965, 3202446], [3202447, 4269928], [4269929, 5337410], [5337411, 6404892], [6404893, 7472374], [7472375, 8539856], [8539857, 9607338], [9607339, 10674820], [10674821, 11742302], [11742303, 12809784], [12809785, 13877266], [13877267, 14944748], [14944749, 16012230], [16012231, 17079712], [17079713, 18147194], [18147195, 19214676], [19214677, 20282158], [20282159, 21349646]] SRR21853454 file size 5752631 SRR21853454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853454 SRR21853454_1.fastq Input file: SRR21853454_1.fastq trimmed: SRR21853454-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:13:21 2024 >> started Fri Dec 6 15:13:32 2024 >> done (11.483s) 21349646 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 82547 ( 0.39%) empty reads filtered out after trimming by size control 21267088 (99.61%) reads available; of these: 647 ( 0.00%) trimmed reads available after processing 21266441 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 3 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 14 0.00% 32 8 0.00% 33 17 0.00% 34 5 0.00% 35 25 0.00% 36 13 0.00% 37 15 0.00% 38 19 0.00% 39 14 0.00% 40 22 0.00% 41 16 0.00% 42 25 0.00% 43 35 0.00% 44 24 0.00% 45 13 0.00% 46 28 0.00% 47 20 0.00% 48 26 0.00% 49 29 0.00% 50 28 0.00% 51 23 0.00% 52 34 0.00% 53 22 0.00% 54 41 0.00% 55 21 0.00% 56 43 0.00% 57 36 0.00% 58 45 0.00% 59 35 0.00% 60 32 0.00% 61 50 0.00% 62 33 0.00% 63 39 0.00% 64 47 0.00% 65 52 0.00% 66 41 0.00% 67 47 0.00% 68 57 0.00% 69 48 0.00% 70 54 0.00% 71 54 0.00% 72 49 0.00% 73 48 0.00% 74 56 0.00% 75 45 0.00% 76 49 0.00% 77 60 0.00% 78 62 0.00% 79 59 0.00% 80 61 0.00% 81 62 0.00% 82 74 0.00% 83 78 0.00% 84 78 0.00% 85 82 0.00% 86 78 0.00% 87 92 0.00% 88 119 0.00% 89 155 0.00% 90 256 0.00% 91 821 0.00% 92 225 0.00% 93 326 0.00% 94 1037 0.00% 95 4536 0.02% 96 28911 0.14% 97 107763 0.51% 98 412842 1.94% 99 1440117 6.77% 100 5113214 24.04% 101 14154472 66.56% 21267088 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.09 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=254.45 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.4 sequence=CGCCGCCGCCGTC Started job on | Dec 06 15:13:51 Started mapping on | Dec 06 15:13:51 Finished on | Dec 06 15:14:38 Mapping speed, Million of reads per hour | 1628.97 Number of input reads | 21267088 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19045294 Uniquely mapped reads % | 89.55% Average mapped length | 100.29 Number of splices: Total | 7164782 Number of splices: Annotated (sjdb) | 6796935 Number of splices: GT/AG | 7073540 Number of splices: GC/AG | 81146 Number of splices: AT/AC | 4515 Number of splices: Non-canonical | 5581 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 581745 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 434870 % of reads mapped to too many loci | 2.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1640049 1640049 1640049 N_multimapping 581745 581745 581745 N_noFeature 975857 10072426 9692591 N_ambiguous 292052 18097 20034 UnstrandedReadsAssigned:17777385 PositiveStrandReadsAssigned:8954771 NegativeStrandReadsAssigned:9332669 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853454 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853454-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,267,088 reads, 18,372,163 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR21853454.ke.tsv 35125 SRR21853454.se.tsv 88098 total ==> SRR21853454.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.310741 0.0375943 PNS24247 1044 945 118.011 12.6456 PNS24249 1928 1829 137.093 7.59015 PNS24246 1044 945 118.011 12.6456 PNS24248 1044 945 118.011 12.6456 PNS24244 1471 1372 117.563 8.67689 PNS24243 293 194 41 21.4009 KQK14069 1603 1504 6685.25 450.11 KQK14071 474 375 1536.92 415.021 ==> SRR21853454.se.tsv <== BRADI_1g14170v3 9570 BRADI_1g53295v3 144 BRADI_1g59795v3 584 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 388 BRADI_1g74790v3 211 BRADI_1g09890v3 0 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR21853454 completed mapping pipeline successfully