Starting /dee2/code/volunteer_pipeline.sh SRR21853455 current disk space = 1550395191296 free memory = 1598206136 SRR21853455 SRAfilesize 4404adf44fc1d65ba35e4f4cc7a055e4 SRR21853455.sra SRR21853455.sra file validated SRR21853455 is single end SRR21853455 is conventional basespace SRR21853455 read1 length is 92-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 92-101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.25 37.0 37.0 37.0 37.0 37.0 2 34.8235 37.0 37.0 37.0 25.0 37.0 3 35.5315 37.0 37.0 37.0 37.0 37.0 4 35.631 37.0 37.0 37.0 37.0 37.0 5 35.7805 37.0 37.0 37.0 37.0 37.0 6 35.7635 37.0 37.0 37.0 37.0 37.0 7 35.685 37.0 37.0 37.0 37.0 37.0 8 35.761 37.0 37.0 37.0 37.0 37.0 9 35.6265 37.0 37.0 37.0 37.0 37.0 10-11 35.794250000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.718999999999994 37.0 37.0 37.0 37.0 37.0 14-15 35.771 37.0 37.0 37.0 37.0 37.0 16-17 35.804249999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.78325 37.0 37.0 37.0 37.0 37.0 20-21 35.646 37.0 37.0 37.0 37.0 37.0 22-23 35.809749999999994 37.0 37.0 37.0 37.0 37.0 24-25 35.7265 37.0 37.0 37.0 37.0 37.0 26-27 35.582 37.0 37.0 37.0 37.0 37.0 28-29 35.55275 37.0 37.0 37.0 37.0 37.0 30-31 35.622749999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.5225 37.0 37.0 37.0 37.0 37.0 34-35 35.648250000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.507000000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.55 37.0 37.0 37.0 37.0 37.0 40-41 35.47775 37.0 37.0 37.0 37.0 37.0 42-43 35.421 37.0 37.0 37.0 37.0 37.0 44-45 35.3095 37.0 37.0 37.0 37.0 37.0 46-47 35.524249999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.42425 37.0 37.0 37.0 37.0 37.0 50-51 35.444500000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.45325 37.0 37.0 37.0 37.0 37.0 54-55 35.35525 37.0 37.0 37.0 37.0 37.0 56-57 35.52575 37.0 37.0 37.0 37.0 37.0 58-59 35.383250000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.409 37.0 37.0 37.0 37.0 37.0 62-63 35.33625 37.0 37.0 37.0 37.0 37.0 64-65 35.31075 37.0 37.0 37.0 31.0 37.0 66-67 35.261250000000004 37.0 37.0 37.0 31.0 37.0 68-69 35.2325 37.0 37.0 37.0 25.0 37.0 70-71 35.283500000000004 37.0 37.0 37.0 37.0 37.0 72-73 35.26125 37.0 37.0 37.0 37.0 37.0 74-75 35.3705 37.0 37.0 37.0 37.0 37.0 76-77 35.2585 37.0 37.0 37.0 31.0 37.0 78-79 35.2315 37.0 37.0 37.0 31.0 37.0 80-81 35.292249999999996 37.0 37.0 37.0 37.0 37.0 82-83 35.23275 37.0 37.0 37.0 25.0 37.0 84-85 35.19475 37.0 37.0 37.0 31.0 37.0 86-87 35.307 37.0 37.0 37.0 31.0 37.0 88-89 35.230000000000004 37.0 37.0 37.0 25.0 37.0 90-91 35.26325 37.0 37.0 37.0 31.0 37.0 92-93 35.16975818954739 37.0 37.0 37.0 31.0 37.0 94-95 35.14979157495728 37.0 37.0 37.0 31.0 37.0 96-97 35.16664062762112 37.0 37.0 37.0 25.0 37.0 98-99 35.174402621227216 37.0 37.0 37.0 31.0 37.0 100-101 34.949400756543056 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 6.0 25 11.0 26 14.0 27 21.0 28 34.0 29 59.0 30 63.0 31 118.0 32 144.0 33 232.0 34 259.0 35 601.0 36 2104.0 37 329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.4 13.875000000000002 20.95 39.775 2 24.429223744292237 20.2181633688483 32.29325215626586 23.059360730593607 3 24.349999999999998 22.55 26.474999999999998 26.625 4 25.724999999999998 28.749999999999996 19.55 25.974999999999998 5 27.3 31.3 21.6 19.8 6 21.425 34.775 20.424999999999997 23.375 7 19.7 19.225 39.0 22.075 8 22.900000000000002 23.425 25.074999999999996 28.599999999999998 9 22.25 22.225 29.9 25.624999999999996 10-11 25.924999999999997 27.462500000000002 21.637500000000003 24.975 12-13 23.35 23.5875 26.2625 26.8 14-15 23.9375 26.200000000000003 25.0 24.8625 16-17 23.175 27.1 24.7875 24.9375 18-19 24.2375 25.5375 25.5 24.725 20-21 23.0875 25.5 26.437500000000004 24.975 22-23 23.4625 26.150000000000002 26.1125 24.275 24-25 23.1125 26.450000000000003 25.362499999999997 25.074999999999996 26-27 24.2 25.362499999999997 25.0375 25.4 28-29 23.7 26.087500000000002 25.5625 24.65 30-31 23.4375 25.162499999999998 26.5875 24.8125 32-33 23.3875 26.9125 24.625 25.074999999999996 34-35 24.025 26.775 25.900000000000002 23.3 36-37 22.9625 25.2125 25.7 26.125 38-39 24.2625 25.974999999999998 25.624999999999996 24.1375 40-41 24.45 25.5625 24.9 25.087500000000002 42-43 24.175 26.1 25.4875 24.2375 44-45 23.2125 26.3 26.224999999999998 24.2625 46-47 24.4375 24.8 25.924999999999997 24.837500000000002 48-49 23.225 26.1625 26.674999999999997 23.9375 50-51 24.762500000000003 25.424999999999997 25.937500000000004 23.875 52-53 23.65 26.337500000000002 24.6875 25.324999999999996 54-55 24.087500000000002 25.837500000000002 25.2125 24.8625 56-57 24.4 25.35 26.4125 23.8375 58-59 23.200000000000003 25.724999999999998 26.3125 24.762500000000003 60-61 25.2875 24.7375 24.9375 25.0375 62-63 24.2 25.85 24.775 25.174999999999997 64-65 23.7125 25.7125 26.125 24.45 66-67 23.549999999999997 26.2125 25.412499999999998 24.825 68-69 23.3125 26.7625 25.525 24.4 70-71 23.8375 25.8625 25.05 25.25 72-73 23.974999999999998 27.325 25.224999999999998 23.474999999999998 74-75 24.212500000000002 25.95 25.4875 24.349999999999998 76-77 24.45 25.587500000000002 25.124999999999996 24.837500000000002 78-79 25.45 26.0 25.474999999999998 23.075000000000003 80-81 23.7 26.237500000000004 25.75 24.3125 82-83 25.2 25.662499999999998 24.9375 24.2 84-85 23.925 25.662499999999998 25.687500000000004 24.725 86-87 24.2875 26.5125 24.9375 24.2625 88-89 23.9125 26.2875 25.2125 24.587500000000002 90-91 23.974999999999998 25.25 25.7 25.074999999999996 92-93 23.75296912114014 25.62820352544068 26.35329416177022 24.265533191648956 94-95 24.234087782918596 25.97223958984619 26.20982868575716 23.583843941478055 96-97 23.642732049036777 26.257192894671004 25.906930197648236 24.193144858643983 98-99 24.436521074748505 24.398319113714503 26.244747230357824 24.920412581179168 100-101 26.827717736808648 11.649713922441194 31.770502225047682 29.75206611570248 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 3.5 2 3.5 3 2.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.0 26 3.5 27 4.5 28 6.5 29 7.5 30 9.5 31 14.5 32 18.0 33 22.5 34 28.0 35 40.0 36 55.5 37 62.5 38 79.5 39 97.5 40 127.0 41 159.0 42 178.5 43 195.5 44 202.0 45 215.5 46 207.0 47 202.5 48 197.5 49 179.0 50 167.0 51 139.0 52 121.0 53 119.5 54 115.5 55 106.0 56 94.5 57 86.5 58 80.0 59 66.5 60 59.5 61 60.0 62 53.0 63 44.0 64 38.5 65 39.0 66 41.5 67 37.5 68 32.5 69 33.5 70 30.5 71 23.0 72 19.0 73 14.0 74 11.5 75 10.5 76 12.0 77 10.5 78 4.5 79 2.0 80 1.5 81 1.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92 1.0 93 0.0 94 1.0 95 0.0 96 2.0 97 28.0 98 83.0 99 267.0 100 944.0 101 2674.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.626138189609 87.4 2 5.945366898768077 11.1 3 0.34815211569362614 0.975 4 0.02678093197643278 0.1 5 0.02678093197643278 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02678093197643278 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 12 0.3 TruSeq Adapter, Index 3 (97% over 36bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827427 spots for SRR21853455.sra Written 827427 spots for SRR21853455.sra Read 827433 spots for SRR21853455.sra Written 827433 spots for SRR21853455.sra SRR ids: ['SRR21853455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cet4hl5o SRR21853455.sra spots: 16548546 blocks: [[1, 827427], [827428, 1654854], [1654855, 2482281], [2482282, 3309708], [3309709, 4137135], [4137136, 4964562], [4964563, 5791989], [5791990, 6619416], [6619417, 7446843], [7446844, 8274270], [8274271, 9101697], [9101698, 9929124], [9929125, 10756551], [10756552, 11583978], [11583979, 12411405], [12411406, 13238832], [13238833, 14066259], [14066260, 14893686], [14893687, 15721113], [15721114, 16548546]] SRR21853455 file size 4456385 SRR21853455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853455 SRR21853455_1.fastq Input file: SRR21853455_1.fastq trimmed: SRR21853455-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:14:31 2024 >> started Fri Dec 6 15:14:39 2024 >> done (7.896s) 16548546 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 106951 ( 0.65%) empty reads filtered out after trimming by size control 16441584 (99.35%) reads available; of these: 290 ( 0.00%) trimmed reads available after processing 16441294 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 8 0.00% 28 2 0.00% 29 1 0.00% 30 2 0.00% 31 4 0.00% 32 3 0.00% 33 0 0.00% 34 5 0.00% 35 46 0.00% 36 31 0.00% 37 32 0.00% 38 38 0.00% 39 42 0.00% 40 45 0.00% 41 48 0.00% 42 44 0.00% 43 43 0.00% 44 62 0.00% 45 47 0.00% 46 56 0.00% 47 52 0.00% 48 49 0.00% 49 46 0.00% 50 52 0.00% 51 54 0.00% 52 59 0.00% 53 63 0.00% 54 61 0.00% 55 66 0.00% 56 72 0.00% 57 55 0.00% 58 65 0.00% 59 75 0.00% 60 75 0.00% 61 73 0.00% 62 94 0.00% 63 75 0.00% 64 78 0.00% 65 74 0.00% 66 75 0.00% 67 73 0.00% 68 110 0.00% 69 98 0.00% 70 80 0.00% 71 86 0.00% 72 78 0.00% 73 99 0.00% 74 83 0.00% 75 95 0.00% 76 98 0.00% 77 93 0.00% 78 114 0.00% 79 132 0.00% 80 128 0.00% 81 115 0.00% 82 109 0.00% 83 133 0.00% 84 121 0.00% 85 122 0.00% 86 132 0.00% 87 180 0.00% 88 137 0.00% 89 214 0.00% 90 293 0.00% 91 752 0.00% 92 247 0.00% 93 383 0.00% 94 837 0.01% 95 3436 0.02% 96 22295 0.14% 97 82956 0.50% 98 320455 1.95% 99 1115432 6.78% 100 3949055 24.02% 101 10940925 66.54% 16441584 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.09 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=249.47 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=20.8 sequence=CGCCGCCGCCGTC Started job on | Dec 06 15:15:07 Started mapping on | Dec 06 15:15:07 Finished on | Dec 06 15:15:42 Mapping speed, Million of reads per hour | 1691.13 Number of input reads | 16441584 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14711711 Uniquely mapped reads % | 89.48% Average mapped length | 100.27 Number of splices: Total | 5534997 Number of splices: Annotated (sjdb) | 5251721 Number of splices: GT/AG | 5464214 Number of splices: GC/AG | 62628 Number of splices: AT/AC | 3625 Number of splices: Non-canonical | 4530 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 452226 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 330529 % of reads mapped to too many loci | 2.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.46% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1277647 1277647 1277647 N_multimapping 452226 452226 452226 N_noFeature 740634 7765711 7486162 N_ambiguous 228426 14154 15517 UnstrandedReadsAssigned:13742651 PositiveStrandReadsAssigned:6931846 NegativeStrandReadsAssigned:7210032 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853455 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853455-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,441,584 reads, 14,192,761 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR21853455.ke.tsv 35125 SRR21853455.se.tsv 88098 total ==> SRR21853455.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 46.824 7.28437 PNS24247 1044 945 80.6727 11.1159 PNS24249 1928 1829 106.089 7.55279 PNS24246 1044 945 80.6727 11.1159 PNS24248 1044 945 80.6727 11.1159 PNS24244 1471 1372 102.069 9.68695 PNS24243 293 194 24 16.1086 KQK14069 1603 1504 5303.66 459.174 KQK14071 474 375 1331.45 462.319 ==> SRR21853455.se.tsv <== BRADI_1g14170v3 7719 BRADI_1g53295v3 115 BRADI_1g59795v3 462 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 260 BRADI_1g74790v3 170 BRADI_1g09890v3 0 BRADI_1g77505v3 204 BRADI_1g48960v3 0 SRR21853455 completed mapping pipeline successfully