Starting /dee2/code/volunteer_pipeline.sh SRR21853456 current disk space = 1550384623616 free memory = 1291340744 SRR21853456 SRAfilesize 98cb7efdbd6bf3c373ac23087b6bc064 SRR21853456.sra SRR21853456.sra file validated SRR21853456 is single end SRR21853456 is conventional basespace SRR21853456 read1 length is 87-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 87-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0235 37.0 37.0 37.0 25.0 37.0 2 34.73525 37.0 37.0 37.0 25.0 37.0 3 35.44 37.0 37.0 37.0 37.0 37.0 4 35.6275 37.0 37.0 37.0 37.0 37.0 5 35.665 37.0 37.0 37.0 37.0 37.0 6 35.7105 37.0 37.0 37.0 37.0 37.0 7 35.5445 37.0 37.0 37.0 37.0 37.0 8 35.932 37.0 37.0 37.0 37.0 37.0 9 35.788 37.0 37.0 37.0 37.0 37.0 10-11 35.9365 37.0 37.0 37.0 37.0 37.0 12-13 35.794250000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.806250000000006 37.0 37.0 37.0 37.0 37.0 16-17 35.844 37.0 37.0 37.0 37.0 37.0 18-19 35.73425 37.0 37.0 37.0 37.0 37.0 20-21 35.7055 37.0 37.0 37.0 37.0 37.0 22-23 35.6815 37.0 37.0 37.0 37.0 37.0 24-25 35.62325 37.0 37.0 37.0 37.0 37.0 26-27 35.6255 37.0 37.0 37.0 37.0 37.0 28-29 35.6155 37.0 37.0 37.0 37.0 37.0 30-31 35.594750000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.55875 37.0 37.0 37.0 37.0 37.0 34-35 35.567 37.0 37.0 37.0 37.0 37.0 36-37 35.4135 37.0 37.0 37.0 31.0 37.0 38-39 35.46775 37.0 37.0 37.0 37.0 37.0 40-41 35.407250000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.38775 37.0 37.0 37.0 37.0 37.0 44-45 35.44175 37.0 37.0 37.0 37.0 37.0 46-47 35.403499999999994 37.0 37.0 37.0 37.0 37.0 48-49 35.47825 37.0 37.0 37.0 37.0 37.0 50-51 35.312 37.0 37.0 37.0 37.0 37.0 52-53 35.286249999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.21625 37.0 37.0 37.0 31.0 37.0 56-57 35.41575 37.0 37.0 37.0 37.0 37.0 58-59 35.39125 37.0 37.0 37.0 37.0 37.0 60-61 35.303250000000006 37.0 37.0 37.0 37.0 37.0 62-63 35.29125 37.0 37.0 37.0 31.0 37.0 64-65 35.184250000000006 37.0 37.0 37.0 25.0 37.0 66-67 35.215 37.0 37.0 37.0 31.0 37.0 68-69 35.20725 37.0 37.0 37.0 25.0 37.0 70-71 35.0305 37.0 37.0 37.0 25.0 37.0 72-73 35.26475 37.0 37.0 37.0 37.0 37.0 74-75 35.181 37.0 37.0 37.0 31.0 37.0 76-77 35.1545 37.0 37.0 37.0 31.0 37.0 78-79 35.113749999999996 37.0 37.0 37.0 25.0 37.0 80-81 35.141000000000005 37.0 37.0 37.0 31.0 37.0 82-83 35.068 37.0 37.0 37.0 25.0 37.0 84-85 35.14425 37.0 37.0 37.0 25.0 37.0 86-87 35.0555 37.0 37.0 37.0 25.0 37.0 88-89 35.177294323580895 37.0 37.0 37.0 31.0 37.0 90-91 35.118029507376846 37.0 37.0 37.0 25.0 37.0 92-93 34.96424106026507 37.0 37.0 37.0 25.0 37.0 94-95 34.967991997999505 37.0 37.0 37.0 25.0 37.0 96-97 35.057308448916494 37.0 37.0 37.0 25.0 37.0 98-99 35.06366612008566 37.0 37.0 37.0 25.0 37.0 100-101 35.03672884886808 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 4.0 23 4.0 24 5.0 25 10.0 26 17.0 27 22.0 28 42.0 29 64.0 30 91.0 31 106.0 32 144.0 33 202.0 34 301.0 35 550.0 36 2064.0 37 370.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.425 13.525 19.55 37.5 2 25.08276037687802 18.36007130124777 30.863254392666157 25.693913929208044 3 26.325 23.45 24.65 25.575 4 28.275 27.425 19.075 25.224999999999998 5 27.175 30.349999999999998 20.8 21.675 6 23.05 32.0 20.7 24.25 7 20.25 18.7 37.05 24.0 8 20.599999999999998 22.5 26.700000000000003 30.2 9 22.775000000000002 21.625 28.000000000000004 27.6 10-11 24.95 27.8125 21.5 25.7375 12-13 23.925 22.925 25.85 27.3 14-15 23.65 24.349999999999998 26.0 26.0 16-17 25.074999999999996 23.8375 25.374999999999996 25.7125 18-19 25.2875 24.5125 24.762500000000003 25.4375 20-21 24.1125 24.637500000000003 25.2125 26.0375 22-23 24.9375 24.45 24.425 26.187500000000004 24-25 24.5375 24.7875 25.5 25.174999999999997 26-27 24.125 24.675 25.2625 25.937500000000004 28-29 25.0625 24.462500000000002 24.087500000000002 26.387500000000003 30-31 23.9125 25.1875 25.124999999999996 25.775 32-33 23.150000000000002 25.162499999999998 25.474999999999998 26.2125 34-35 24.9125 25.025 25.0375 25.025 36-37 24.7375 24.712500000000002 24.712500000000002 25.837500000000002 38-39 24.837500000000002 25.1875 24.425 25.55 40-41 25.224999999999998 24.2875 24.6 25.887500000000003 42-43 24.349999999999998 25.25 24.8125 25.587500000000002 44-45 23.6125 25.7 24.5375 26.150000000000002 46-47 24.8 25.7875 24.075 25.337500000000002 48-49 24.4125 24.875 24.8125 25.900000000000002 50-51 24.1375 25.5 24.4125 25.95 52-53 24.875 24.55 24.4875 26.087500000000002 54-55 23.9875 24.975 25.8125 25.224999999999998 56-57 25.7375 23.7625 25.35 25.15 58-59 25.3 24.175 24.375 26.150000000000002 60-61 24.6875 25.0 24.85 25.4625 62-63 25.35 24.8125 25.05 24.7875 64-65 24.975 24.4 24.4875 26.137500000000003 66-67 24.675 25.2125 24.125 25.9875 68-69 24.95 24.7 24.875 25.474999999999998 70-71 24.9375 24.675 24.3125 26.075 72-73 24.462500000000002 25.0125 24.4375 26.087500000000002 74-75 24.55 25.575 24.6 25.275 76-77 24.9375 24.825 23.6125 26.625 78-79 25.662499999999998 24.2625 24.9875 25.087500000000002 80-81 25.6 25.162499999999998 23.474999999999998 25.7625 82-83 24.7 25.637500000000003 24.05 25.6125 84-85 25.75 25.0375 24.55 24.6625 86-87 25.4 24.65 24.2 25.75 88-89 25.381345336334082 24.20605151287822 24.793698424606152 25.618904726181547 90-91 25.23130782695674 24.793698424606152 24.831207801950487 25.143785946486624 92-93 25.156289072268066 24.656164041010253 24.36859214803701 25.818954738684667 94-95 25.10627656914228 24.318579644911228 24.493623405851466 26.081520380095025 96-97 25.225225225225223 24.01151151151151 24.56206206206206 26.2012012012012 98-99 25.76236872073896 23.472099202834368 25.142351005947113 25.623181070479568 100-101 26.18345491230793 10.678255471053857 30.125717833307462 33.01257178333075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 4.0 2 2.0 3 3.0 4 1.0 5 0.5 6 1.0 7 2.0 8 1.5 9 0.0 10 1.0 11 2.0 12 1.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 1.5 28 2.5 29 3.5 30 8.5 31 12.0 32 15.0 33 21.0 34 29.0 35 36.5 36 42.5 37 54.0 38 75.5 39 92.0 40 116.0 41 139.5 42 148.5 43 157.5 44 156.0 45 172.5 46 199.0 47 202.5 48 188.0 49 169.5 50 147.5 51 130.5 52 115.5 53 107.0 54 96.5 55 85.5 56 90.0 57 91.5 58 79.5 59 63.5 60 63.5 61 69.0 62 70.0 63 71.0 64 66.5 65 60.0 66 60.0 67 59.5 68 59.5 69 54.0 70 42.5 71 38.0 72 36.5 73 32.5 74 33.5 75 31.5 76 25.5 77 19.0 78 13.0 79 8.0 80 3.5 81 2.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.825 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 4.0 97 12.0 98 61.0 99 256.0 100 887.0 101 2778.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.32907348242811 88.575 2 5.244941427050053 9.85 3 0.34611288604898827 0.975 4 0.026624068157614485 0.1 5 0.026624068157614485 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026624068157614485 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 15 0.375 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851169 spots for SRR21853456.sra Written 851169 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra Read 851166 spots for SRR21853456.sra Written 851166 spots for SRR21853456.sra SRR ids: ['SRR21853456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i5a2fo5j SRR21853456.sra spots: 17023323 blocks: [[1, 851166], [851167, 1702332], [1702333, 2553498], [2553499, 3404664], [3404665, 4255830], [4255831, 5106996], [5106997, 5958162], [5958163, 6809328], [6809329, 7660494], [7660495, 8511660], [8511661, 9362826], [9362827, 10213992], [10213993, 11065158], [11065159, 11916324], [11916325, 12767490], [12767491, 13618656], [13618657, 14469822], [14469823, 15320988], [15320989, 16172154], [16172155, 17023323]] SRR21853456 file size 4584826 SRR21853456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853456 SRR21853456_1.fastq Input file: SRR21853456_1.fastq trimmed: SRR21853456-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:15:03 2024 >> started Fri Dec 6 15:15:15 2024 >> done (11.880s) 17023323 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 18536 ( 0.11%) empty reads filtered out after trimming by size control 17004783 (99.89%) reads available; of these: 338 ( 0.00%) trimmed reads available after processing 17004445 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 6 0.00% 31 1 0.00% 32 6 0.00% 33 4 0.00% 34 8 0.00% 35 55 0.00% 36 34 0.00% 37 52 0.00% 38 52 0.00% 39 50 0.00% 40 55 0.00% 41 51 0.00% 42 53 0.00% 43 67 0.00% 44 63 0.00% 45 63 0.00% 46 77 0.00% 47 81 0.00% 48 76 0.00% 49 70 0.00% 50 65 0.00% 51 73 0.00% 52 74 0.00% 53 80 0.00% 54 104 0.00% 55 87 0.00% 56 76 0.00% 57 92 0.00% 58 95 0.00% 59 99 0.00% 60 99 0.00% 61 150 0.00% 62 125 0.00% 63 108 0.00% 64 123 0.00% 65 124 0.00% 66 109 0.00% 67 123 0.00% 68 119 0.00% 69 118 0.00% 70 152 0.00% 71 138 0.00% 72 132 0.00% 73 149 0.00% 74 132 0.00% 75 133 0.00% 76 139 0.00% 77 167 0.00% 78 180 0.00% 79 216 0.00% 80 195 0.00% 81 196 0.00% 82 194 0.00% 83 185 0.00% 84 224 0.00% 85 234 0.00% 86 247 0.00% 87 277 0.00% 88 227 0.00% 89 347 0.00% 90 410 0.00% 91 876 0.01% 92 395 0.00% 93 509 0.00% 94 1200 0.01% 95 4181 0.02% 96 23624 0.14% 97 81006 0.48% 98 316798 1.86% 99 1135596 6.68% 100 3913854 23.02% 101 11519479 67.74% 17004783 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=205.57 fanout-score-rank=15 prefix-density=0.79 prefix-fanout=24.7 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=411.58 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=24.7 sequence=CGCCGCCGCCATC Started job on | Dec 06 15:15:41 Started mapping on | Dec 06 15:15:41 Finished on | Dec 06 15:16:23 Mapping speed, Million of reads per hour | 1457.55 Number of input reads | 17004783 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15593422 Uniquely mapped reads % | 91.70% Average mapped length | 100.25 Number of splices: Total | 5400151 Number of splices: Annotated (sjdb) | 5118268 Number of splices: GT/AG | 5329793 Number of splices: GC/AG | 59954 Number of splices: AT/AC | 3434 Number of splices: Non-canonical | 6970 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330135 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 257254 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.63% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1081226 1081226 1081226 N_multimapping 330135 330135 330135 N_noFeature 677368 8047586 8006888 N_ambiguous 243864 14202 15286 UnstrandedReadsAssigned:14672190 PositiveStrandReadsAssigned:7531634 NegativeStrandReadsAssigned:7571248 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853456 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853456-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,004,783 reads, 15,142,894 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR21853456.ke.tsv 35125 SRR21853456.se.tsv 88098 total ==> SRR21853456.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 22.5245 3.10033 PNS24247 1044 945 72.2783 8.8116 PNS24249 1928 1829 188.966 11.9028 PNS24246 1044 945 72.2783 8.8116 PNS24248 1044 945 72.2783 8.8116 PNS24244 1471 1372 73.6743 6.18643 PNS24243 293 194 28 16.6278 KQK14069 1603 1504 8684.52 665.237 KQK14071 474 375 1756.82 539.727 ==> SRR21853456.se.tsv <== BRADI_1g14170v3 11702 BRADI_1g53295v3 112 BRADI_1g59795v3 433 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 259 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 216 BRADI_1g48960v3 1 SRR21853456 completed mapping pipeline successfully