Starting /dee2/code/volunteer_pipeline.sh SRR21853457 current disk space = 1550355382272 free memory = 1596334292 SRR21853457 SRAfilesize cf764da286f6ddd531b4f1ced6a1b557 SRR21853457.sra SRR21853457.sra file validated SRR21853457 is single end SRR21853457 is conventional basespace SRR21853457 read1 length is 94-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 94-101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.517 37.0 37.0 37.0 37.0 37.0 2 35.6565 37.0 37.0 37.0 37.0 37.0 3 35.7835 37.0 37.0 37.0 37.0 37.0 4 35.777 37.0 37.0 37.0 37.0 37.0 5 35.8555 37.0 37.0 37.0 37.0 37.0 6 36.074 37.0 37.0 37.0 37.0 37.0 7 35.9005 37.0 37.0 37.0 37.0 37.0 8 36.037 37.0 37.0 37.0 37.0 37.0 9 35.9645 37.0 37.0 37.0 37.0 37.0 10-11 35.90425 37.0 37.0 37.0 37.0 37.0 12-13 36.033249999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.878 37.0 37.0 37.0 37.0 37.0 16-17 35.912 37.0 37.0 37.0 37.0 37.0 18-19 35.79475 37.0 37.0 37.0 37.0 37.0 20-21 35.788 37.0 37.0 37.0 37.0 37.0 22-23 35.866749999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.89125 37.0 37.0 37.0 37.0 37.0 26-27 35.693250000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.74 37.0 37.0 37.0 37.0 37.0 30-31 35.639250000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.780249999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.7515 37.0 37.0 37.0 37.0 37.0 36-37 35.706500000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.839 37.0 37.0 37.0 37.0 37.0 40-41 35.809250000000006 37.0 37.0 37.0 37.0 37.0 42-43 35.7605 37.0 37.0 37.0 37.0 37.0 44-45 35.6425 37.0 37.0 37.0 37.0 37.0 46-47 35.744749999999996 37.0 37.0 37.0 37.0 37.0 48-49 35.491 37.0 37.0 37.0 37.0 37.0 50-51 35.588 37.0 37.0 37.0 37.0 37.0 52-53 35.625249999999994 37.0 37.0 37.0 37.0 37.0 54-55 35.703500000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.6045 37.0 37.0 37.0 37.0 37.0 58-59 35.636250000000004 37.0 37.0 37.0 37.0 37.0 60-61 35.653999999999996 37.0 37.0 37.0 37.0 37.0 62-63 35.606750000000005 37.0 37.0 37.0 37.0 37.0 64-65 35.66675 37.0 37.0 37.0 37.0 37.0 66-67 35.614000000000004 37.0 37.0 37.0 37.0 37.0 68-69 35.59 37.0 37.0 37.0 37.0 37.0 70-71 35.61825 37.0 37.0 37.0 37.0 37.0 72-73 35.54725 37.0 37.0 37.0 37.0 37.0 74-75 35.534499999999994 37.0 37.0 37.0 37.0 37.0 76-77 35.5895 37.0 37.0 37.0 37.0 37.0 78-79 35.6495 37.0 37.0 37.0 37.0 37.0 80-81 35.572 37.0 37.0 37.0 37.0 37.0 82-83 35.61 37.0 37.0 37.0 37.0 37.0 84-85 35.6315 37.0 37.0 37.0 37.0 37.0 86-87 35.5595 37.0 37.0 37.0 37.0 37.0 88-89 35.4035 37.0 37.0 37.0 37.0 37.0 90-91 35.510000000000005 37.0 37.0 37.0 37.0 37.0 92-93 35.53775 37.0 37.0 37.0 37.0 37.0 94-95 35.47230438859715 37.0 37.0 37.0 37.0 37.0 96-97 35.58146181480174 37.0 37.0 37.0 37.0 37.0 98-99 35.458702918895355 37.0 37.0 37.0 37.0 37.0 100-101 35.253691478630486 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 4.0 24 4.0 25 6.0 26 7.0 27 28.0 28 24.0 29 48.0 30 60.0 31 98.0 32 105.0 33 183.0 34 252.0 35 445.0 36 2252.0 37 482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.575 19.950000000000003 16.2 35.275 2 25.1 21.25 26.150000000000002 27.500000000000004 3 26.325 17.5 24.45 31.724999999999998 4 25.974999999999998 21.325 22.6 30.099999999999998 5 29.65 25.1 22.8 22.45 6 24.8 30.525000000000002 22.7 21.975 7 20.4 26.325 34.050000000000004 19.225 8 20.925 27.500000000000004 29.125 22.45 9 21.675 24.125 30.275000000000002 23.925 10-11 23.325000000000003 29.625 25.174999999999997 21.875 12-13 23.0125 25.775 26.887499999999996 24.325 14-15 22.275 26.700000000000003 27.1625 23.8625 16-17 23.5625 25.525 26.887499999999996 24.025 18-19 22.95 26.625 27.575 22.85 20-21 22.725 27.2625 26.087500000000002 23.925 22-23 23.025000000000002 27.1625 25.95 23.8625 24-25 23.225 26.1625 27.075 23.5375 26-27 23.5375 26.2875 26.275 23.9 28-29 23.1 26.387500000000003 26.5125 24.0 30-31 22.787499999999998 26.5375 26.650000000000002 24.025 32-33 22.9375 27.1375 26.0125 23.9125 34-35 23.1125 26.6125 26.85 23.425 36-37 22.3625 26.8 26.7625 24.075 38-39 23.4375 26.875 26.237500000000004 23.45 40-41 22.8375 27.075 27.3 22.787499999999998 42-43 23.2625 27.200000000000003 26.950000000000003 22.5875 44-45 22.9875 26.3125 26.6625 24.0375 46-47 22.4875 25.825 26.737499999999997 24.95 48-49 23.2125 27.3375 25.912499999999998 23.5375 50-51 23.8125 26.450000000000003 26.75 22.9875 52-53 23.4875 26.5125 26.8625 23.1375 54-55 23.625 26.4125 26.937499999999996 23.025000000000002 56-57 22.6375 26.650000000000002 26.237500000000004 24.474999999999998 58-59 21.6125 26.637499999999996 27.925 23.825 60-61 22.6375 26.1625 27.900000000000002 23.3 62-63 22.237499999999997 26.1 27.250000000000004 24.4125 64-65 23.3875 26.775 26.087500000000002 23.75 66-67 22.625 27.8375 26.6125 22.925 68-69 22.4875 27.6375 26.437500000000004 23.4375 70-71 22.8875 26.8 27.375 22.9375 72-73 23.075000000000003 25.8125 27.1625 23.95 74-75 22.5875 27.0625 26.650000000000002 23.7 76-77 22.662499999999998 26.674999999999997 27.05 23.6125 78-79 22.3625 27.3875 26.025 24.224999999999998 80-81 23.625 26.424999999999997 26.6625 23.2875 82-83 23.6125 26.724999999999998 27.1125 22.55 84-85 23.2125 26.9625 27.474999999999998 22.35 86-87 22.7125 26.25 27.3875 23.65 88-89 23.3875 26.7125 26.375 23.525 90-91 23.474999999999998 26.400000000000002 27.2625 22.8625 92-93 22.3875 27.375 27.250000000000004 22.9875 94-95 22.652831603950492 26.440805100637583 28.20352544068008 22.702837854731843 96-97 23.77613622135971 26.117440841367223 26.73093777388256 23.37548516339051 98-99 22.962112514351322 26.31713228728154 27.337670621252713 23.383084577114428 100-101 24.237070350144556 12.929649855444907 32.97462255059428 29.858657243816257 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 1.5 26 3.5 27 7.5 28 8.5 29 8.0 30 11.5 31 12.5 32 17.0 33 28.5 34 37.0 35 47.0 36 65.0 37 78.0 38 100.0 39 134.5 40 156.5 41 169.0 42 183.5 43 216.0 44 250.0 45 270.0 46 251.0 47 222.5 48 211.0 49 194.0 50 175.5 51 155.0 52 133.5 53 116.0 54 101.0 55 85.5 56 69.0 57 51.0 58 43.5 59 41.0 60 38.5 61 31.5 62 25.0 63 29.0 64 29.0 65 27.5 66 31.5 67 28.0 68 19.5 69 12.5 70 10.5 71 13.5 72 14.0 73 9.5 74 7.5 75 6.5 76 3.0 77 1.5 78 3.0 79 2.5 80 0.5 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 94 1.0 95 0.0 96 11.0 97 26.0 98 85.0 99 284.0 100 960.0 101 2633.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40021231422506 88.925 2 5.360934182590234 10.100000000000001 3 0.21231422505307856 0.6 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02653927813163482 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 15 0.375 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803518 spots for SRR21853457.sra Written 803518 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra Read 803507 spots for SRR21853457.sra Written 803507 spots for SRR21853457.sra SRR ids: ['SRR21853457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k1d9m9o0 SRR21853457.sra spots: 16070151 blocks: [[1, 803507], [803508, 1607014], [1607015, 2410521], [2410522, 3214028], [3214029, 4017535], [4017536, 4821042], [4821043, 5624549], [5624550, 6428056], [6428057, 7231563], [7231564, 8035070], [8035071, 8838577], [8838578, 9642084], [9642085, 10445591], [10445592, 11249098], [11249099, 12052605], [12052606, 12856112], [12856113, 13659619], [13659620, 14463126], [14463127, 15266633], [15266634, 16070151]] SRR21853457 file size 4326126 SRR21853457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853457 SRR21853457_1.fastq Input file: SRR21853457_1.fastq trimmed: SRR21853457-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:15:38 2024 >> started Fri Dec 6 15:15:46 2024 >> done (7.912s) 16070151 reads processed; of these: 19 ( 0.00%) short reads filtered out after trimming by size control 95618 ( 0.60%) empty reads filtered out after trimming by size control 15974514 (99.40%) reads available; of these: 607 ( 0.00%) trimmed reads available after processing 15973907 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 2 0.00% 31 8 0.00% 32 7 0.00% 33 15 0.00% 34 2 0.00% 35 38 0.00% 36 33 0.00% 37 36 0.00% 38 33 0.00% 39 30 0.00% 40 38 0.00% 41 54 0.00% 42 53 0.00% 43 35 0.00% 44 34 0.00% 45 38 0.00% 46 45 0.00% 47 50 0.00% 48 46 0.00% 49 61 0.00% 50 83 0.00% 51 89 0.00% 52 69 0.00% 53 93 0.00% 54 85 0.00% 55 73 0.00% 56 83 0.00% 57 89 0.00% 58 103 0.00% 59 116 0.00% 60 124 0.00% 61 136 0.00% 62 123 0.00% 63 168 0.00% 64 160 0.00% 65 155 0.00% 66 163 0.00% 67 161 0.00% 68 202 0.00% 69 205 0.00% 70 247 0.00% 71 251 0.00% 72 300 0.00% 73 270 0.00% 74 304 0.00% 75 299 0.00% 76 289 0.00% 77 275 0.00% 78 350 0.00% 79 328 0.00% 80 410 0.00% 81 433 0.00% 82 483 0.00% 83 498 0.00% 84 543 0.00% 85 536 0.00% 86 584 0.00% 87 646 0.00% 88 638 0.00% 89 693 0.00% 90 858 0.01% 91 1293 0.01% 92 852 0.01% 93 1110 0.01% 94 1654 0.01% 95 3820 0.02% 96 23295 0.15% 97 87208 0.55% 98 327263 2.05% 99 1090309 6.83% 100 3992947 25.00% 101 10432374 65.31% 15974514 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=36 prefix-density=0.17 prefix-fanout=1.0 sequence=ATCGCGGCCGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=251.63 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=23.0 sequence=CTTCTTCTTCCT Started job on | Dec 06 15:16:03 Started mapping on | Dec 06 15:16:03 Finished on | Dec 06 15:16:45 Mapping speed, Million of reads per hour | 1369.24 Number of input reads | 15974514 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14930091 Uniquely mapped reads % | 93.46% Average mapped length | 100.20 Number of splices: Total | 5887964 Number of splices: Annotated (sjdb) | 5616917 Number of splices: GT/AG | 5811979 Number of splices: GC/AG | 67455 Number of splices: AT/AC | 3948 Number of splices: Non-canonical | 4582 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223537 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 67902 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.64% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 820886 820886 820886 N_multimapping 223537 223537 223537 N_noFeature 891478 8046393 7578840 N_ambiguous 227050 15499 16849 UnstrandedReadsAssigned:13811563 PositiveStrandReadsAssigned:6868199 NegativeStrandReadsAssigned:7334402 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853457 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853457-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,974,514 reads, 14,158,384 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR21853457.ke.tsv 35125 SRR21853457.se.tsv 88098 total ==> SRR21853457.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 64.8478 9.49057 PNS24249 1928 1829 52.5696 3.97512 PNS24246 1044 945 64.8478 9.49057 PNS24248 1044 945 64.8478 9.49057 PNS24244 1471 1372 108.887 10.9762 PNS24243 293 194 12 8.55477 KQK14069 1603 1504 3477.71 319.797 KQK14071 474 375 855.006 315.331 ==> SRR21853457.se.tsv <== BRADI_1g14170v3 5266 BRADI_1g53295v3 167 BRADI_1g59795v3 695 BRADI_1g07683v3 0 BRADI_1g00485v3 46 BRADI_1g20270v3 283 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 304 BRADI_1g48960v3 0 SRR21853457 completed mapping pipeline successfully