Starting /dee2/code/volunteer_pipeline.sh SRR21853458 current disk space = 1550350077952 free memory = 1600239544 SRR21853458 SRAfilesize c0c057851f9aea3c9d5f22fe31a4141f SRR21853458.sra SRR21853458.sra file validated SRR21853458 is single end SRR21853458 is conventional basespace SRR21853458 read1 length is 79-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 79-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.1165 37.0 37.0 37.0 25.0 37.0 2 34.77875 37.0 37.0 37.0 25.0 37.0 3 35.3845 37.0 37.0 37.0 37.0 37.0 4 35.5165 37.0 37.0 37.0 37.0 37.0 5 35.653 37.0 37.0 37.0 37.0 37.0 6 35.631 37.0 37.0 37.0 37.0 37.0 7 35.5285 37.0 37.0 37.0 37.0 37.0 8 35.628 37.0 37.0 37.0 37.0 37.0 9 35.7405 37.0 37.0 37.0 37.0 37.0 10-11 35.832 37.0 37.0 37.0 37.0 37.0 12-13 35.7605 37.0 37.0 37.0 37.0 37.0 14-15 35.778999999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.70399999999999 37.0 37.0 37.0 37.0 37.0 18-19 35.672250000000005 37.0 37.0 37.0 37.0 37.0 20-21 35.745000000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.59675 37.0 37.0 37.0 37.0 37.0 24-25 35.5825 37.0 37.0 37.0 37.0 37.0 26-27 35.55275 37.0 37.0 37.0 37.0 37.0 28-29 35.45375 37.0 37.0 37.0 37.0 37.0 30-31 35.515 37.0 37.0 37.0 37.0 37.0 32-33 35.5785 37.0 37.0 37.0 37.0 37.0 34-35 35.4765 37.0 37.0 37.0 37.0 37.0 36-37 35.463750000000005 37.0 37.0 37.0 37.0 37.0 38-39 35.422250000000005 37.0 37.0 37.0 37.0 37.0 40-41 35.445499999999996 37.0 37.0 37.0 37.0 37.0 42-43 35.45625 37.0 37.0 37.0 37.0 37.0 44-45 35.40375 37.0 37.0 37.0 37.0 37.0 46-47 35.40975 37.0 37.0 37.0 37.0 37.0 48-49 35.417 37.0 37.0 37.0 37.0 37.0 50-51 35.345749999999995 37.0 37.0 37.0 37.0 37.0 52-53 35.4305 37.0 37.0 37.0 37.0 37.0 54-55 35.267250000000004 37.0 37.0 37.0 25.0 37.0 56-57 35.3865 37.0 37.0 37.0 37.0 37.0 58-59 35.445 37.0 37.0 37.0 37.0 37.0 60-61 35.387 37.0 37.0 37.0 37.0 37.0 62-63 35.295500000000004 37.0 37.0 37.0 37.0 37.0 64-65 35.318 37.0 37.0 37.0 37.0 37.0 66-67 35.20525 37.0 37.0 37.0 31.0 37.0 68-69 35.22 37.0 37.0 37.0 31.0 37.0 70-71 35.241249999999994 37.0 37.0 37.0 31.0 37.0 72-73 35.13775 37.0 37.0 37.0 25.0 37.0 74-75 35.221999999999994 37.0 37.0 37.0 25.0 37.0 76-77 35.23375 37.0 37.0 37.0 31.0 37.0 78-79 35.158500000000004 37.0 37.0 37.0 31.0 37.0 80-81 35.05201300325081 37.0 37.0 37.0 25.0 37.0 82-83 35.27631907976995 37.0 37.0 37.0 31.0 37.0 84-85 35.036009002250566 37.0 37.0 37.0 25.0 37.0 86-87 35.23283096912297 37.0 37.0 37.0 25.0 37.0 88-89 35.161371028271205 37.0 37.0 37.0 31.0 37.0 90-91 35.027048947536684 37.0 37.0 37.0 25.0 37.0 92-93 35.15122684026039 37.0 37.0 37.0 25.0 37.0 94-95 35.08212318477717 37.0 37.0 37.0 25.0 37.0 96-97 35.045835035117804 37.0 37.0 37.0 25.0 37.0 98-99 35.063278104537545 37.0 37.0 37.0 25.0 37.0 100-101 34.99250681458608 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 3.0 23 3.0 24 5.0 25 9.0 26 20.0 27 28.0 28 46.0 29 65.0 30 84.0 31 113.0 32 138.0 33 209.0 34 280.0 35 518.0 36 2115.0 37 361.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.95 19.575 15.975 35.5 2 24.72819216182048 20.809102402022756 26.144121365360302 28.31858407079646 3 26.825 20.9 22.075 30.2 4 26.325 23.65 20.825 29.2 5 30.175 25.025 22.25 22.55 6 24.825 30.925000000000004 22.175 22.075 7 20.65 26.525 33.7 19.125 8 22.025 27.700000000000003 27.175 23.1 9 23.200000000000003 22.95 29.475 24.375 10-11 23.375 31.112499999999997 23.625 21.8875 12-13 22.4625 26.625 27.3125 23.599999999999998 14-15 23.599999999999998 26.0125 26.224999999999998 24.1625 16-17 23.0625 25.8125 26.937499999999996 24.1875 18-19 23.2875 27.950000000000003 25.25 23.5125 20-21 23.9125 27.375 24.9 23.8125 22-23 22.912499999999998 27.725 25.45 23.9125 24-25 23.674999999999997 26.700000000000003 26.637499999999996 22.9875 26-27 22.975 26.5875 26.35 24.087500000000002 28-29 23.849999999999998 27.737499999999997 25.374999999999996 23.0375 30-31 22.8 25.637500000000003 27.737499999999997 23.825 32-33 23.5125 26.424999999999997 26.275 23.7875 34-35 22.787499999999998 27.1 26.474999999999998 23.6375 36-37 23.075000000000003 26.3 26.625 24.0 38-39 22.7375 27.650000000000002 25.174999999999997 24.4375 40-41 24.3125 26.200000000000003 25.8125 23.674999999999997 42-43 22.425 27.6125 26.1625 23.799999999999997 44-45 23.775 25.7125 25.9625 24.55 46-47 23.1125 26.5125 25.937500000000004 24.4375 48-49 22.037499999999998 27.425 26.875 23.6625 50-51 23.5875 26.4125 26.6625 23.3375 52-53 22.525000000000002 27.237499999999997 25.724999999999998 24.5125 54-55 24.2625 27.0125 26.424999999999997 22.3 56-57 22.900000000000002 26.950000000000003 26.337500000000002 23.8125 58-59 22.787499999999998 27.35 26.087500000000002 23.775 60-61 23.1375 26.6 26.450000000000003 23.8125 62-63 23.599999999999998 26.55 26.05 23.799999999999997 64-65 23.9125 26.5625 25.8125 23.7125 66-67 22.4375 27.3875 25.887500000000003 24.2875 68-69 22.9375 27.450000000000003 26.0 23.6125 70-71 23.45 27.05 26.525 22.975 72-73 23.5875 27.400000000000002 25.224999999999998 23.7875 74-75 23.3 25.55 26.700000000000003 24.45 76-77 22.75 28.225 26.1 22.925 78-79 23.1 27.525 26.637499999999996 22.7375 80-81 23.20580145036259 26.406601650412604 26.78169542385596 23.605901475368842 82-83 24.093523380845213 26.581645411352838 25.831457864466117 23.493373343335833 84-85 23.53088272068017 27.806951737934483 26.019004751187797 22.643160790197552 86-87 23.383768913342504 26.79754908090534 26.60997874202826 23.208703263723894 88-89 23.605203902927197 26.70753064798599 25.819364523392547 23.867900925694272 90-91 24.224224224224226 25.663163163163162 26.463963963963966 23.64864864864865 92-93 22.984476715072606 27.766649974962444 25.826239359038556 23.42263395092639 94-95 23.610415623435152 26.777666499749625 26.589884827240862 23.02203304957436 96-97 23.478587528174305 26.59654395191585 27.0473328324568 22.877535687453044 98-99 23.932713138779153 25.398241366127184 26.213839683955655 24.455205811138015 100-101 24.91971740526654 12.042389210019268 33.46178548490687 29.57610789980732 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 3.0 26 3.5 27 4.0 28 7.0 29 6.0 30 8.5 31 19.5 32 24.5 33 29.0 34 36.5 35 42.5 36 46.0 37 61.5 38 93.0 39 126.5 40 150.5 41 167.0 42 185.0 43 212.5 44 242.0 45 242.5 46 228.0 47 223.5 48 227.0 49 197.5 50 169.5 51 156.0 52 137.5 53 130.0 54 106.5 55 88.0 56 77.5 57 58.0 58 40.0 59 36.5 60 38.0 61 44.5 62 41.0 63 30.0 64 32.0 65 32.0 66 31.0 67 25.0 68 18.5 69 18.0 70 18.0 71 21.0 72 19.0 73 10.5 74 7.5 75 6.5 76 3.0 77 2.0 78 2.0 79 2.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 2.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 2.0 97 28.0 98 81.0 99 265.0 100 1008.0 101 2610.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.68509168216849 89.075 2 4.863141110815839 9.15 3 0.3720435822482062 1.05 4 0.05314908317831517 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026574541589157584 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 21 0.525 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479589 spots for SRR21853458.sra Written 479589 spots for SRR21853458.sra Read 479590 spots for SRR21853458.sra Written 479590 spots for SRR21853458.sra SRR ids: ['SRR21853458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjcqqxf_ SRR21853458.sra spots: 9591781 blocks: [[1, 479589], [479590, 959178], [959179, 1438767], [1438768, 1918356], [1918357, 2397945], [2397946, 2877534], [2877535, 3357123], [3357124, 3836712], [3836713, 4316301], [4316302, 4795890], [4795891, 5275479], [5275480, 5755068], [5755069, 6234657], [6234658, 6714246], [6714247, 7193835], [7193836, 7673424], [7673425, 8153013], [8153014, 8632602], [8632603, 9112191], [9112192, 9591781]] SRR21853458 file size 2577764 SRR21853458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853458 SRR21853458_1.fastq Input file: SRR21853458_1.fastq trimmed: SRR21853458-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:16:22 2024 >> started Fri Dec 6 15:16:27 2024 >> done (4.916s) 9591781 reads processed; of these: 18 ( 0.00%) short reads filtered out after trimming by size control 95164 ( 0.99%) empty reads filtered out after trimming by size control 9496599 (99.01%) reads available; of these: 228 ( 0.00%) trimmed reads available after processing 9496371 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 3 0.00% 29 6 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 5 0.00% 34 5 0.00% 35 30 0.00% 36 39 0.00% 37 60 0.00% 38 51 0.00% 39 58 0.00% 40 59 0.00% 41 53 0.00% 42 59 0.00% 43 69 0.00% 44 58 0.00% 45 49 0.00% 46 71 0.00% 47 63 0.00% 48 71 0.00% 49 70 0.00% 50 74 0.00% 51 81 0.00% 52 94 0.00% 53 94 0.00% 54 93 0.00% 55 66 0.00% 56 113 0.00% 57 110 0.00% 58 117 0.00% 59 101 0.00% 60 140 0.00% 61 143 0.00% 62 177 0.00% 63 162 0.00% 64 186 0.00% 65 157 0.00% 66 175 0.00% 67 183 0.00% 68 201 0.00% 69 179 0.00% 70 258 0.00% 71 281 0.00% 72 288 0.00% 73 292 0.00% 74 317 0.00% 75 308 0.00% 76 319 0.00% 77 289 0.00% 78 335 0.00% 79 383 0.00% 80 429 0.00% 81 482 0.01% 82 559 0.01% 83 556 0.01% 84 524 0.01% 85 607 0.01% 86 619 0.01% 87 612 0.01% 88 635 0.01% 89 687 0.01% 90 844 0.01% 91 1158 0.01% 92 894 0.01% 93 1045 0.01% 94 1341 0.01% 95 2812 0.03% 96 14222 0.15% 97 52586 0.55% 98 196544 2.07% 99 648600 6.83% 100 2372422 24.98% 101 6191804 65.20% 9496599 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=41 prefix-density=0.00 prefix-fanout=1.0 sequence=GTACTGGATGCATCTGCAGGATATCGCGGCCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=268.90 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=23.5 sequence=GCAGCAGCAGCT Started job on | Dec 06 15:16:50 Started mapping on | Dec 06 15:16:51 Finished on | Dec 06 15:17:12 Mapping speed, Million of reads per hour | 1627.99 Number of input reads | 9496599 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8873653 Uniquely mapped reads % | 93.44% Average mapped length | 100.16 Number of splices: Total | 3504221 Number of splices: Annotated (sjdb) | 3342057 Number of splices: GT/AG | 3458902 Number of splices: GC/AG | 40225 Number of splices: AT/AC | 2342 Number of splices: Non-canonical | 2752 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 133223 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 39175 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 489723 489723 489723 N_multimapping 133223 133223 133223 N_noFeature 523174 4754046 4524382 N_ambiguous 136988 9347 10253 UnstrandedReadsAssigned:8213491 PositiveStrandReadsAssigned:4110260 NegativeStrandReadsAssigned:4339018 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853458 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853458-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,496,599 reads, 8,413,968 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52973 SRR21853458.ke.tsv 35125 SRR21853458.se.tsv 88098 total ==> SRR21853458.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 40.9198 9.98698 PNS24249 1928 1829 33.8927 4.2739 PNS24246 1044 945 40.9198 9.98698 PNS24248 1044 945 40.9198 9.98698 PNS24244 1471 1372 64.3478 10.8171 PNS24243 293 194 11 13.0774 KQK14069 1603 1504 2161.11 331.406 KQK14071 474 375 490.596 301.734 ==> SRR21853458.se.tsv <== BRADI_1g14170v3 3277 BRADI_1g53295v3 84 BRADI_1g59795v3 442 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 181 BRADI_1g74790v3 50 BRADI_1g09890v3 0 BRADI_1g77505v3 206 BRADI_1g48960v3 0 SRR21853458 completed mapping pipeline successfully