Starting /dee2/code/volunteer_pipeline.sh SRR21853459 current disk space = 1550355099648 free memory = 1367865844 SRR21853459 SRAfilesize 3916cf224c8c915b62c677d9c7ef887c SRR21853459.sra SRR21853459.sra file validated SRR21853459 is single end SRR21853459 is conventional basespace SRR21853459 read1 length is 71-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 71-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.269 37.0 37.0 37.0 25.0 37.0 2 35.734 37.0 37.0 37.0 37.0 37.0 3 35.888 37.0 37.0 37.0 37.0 37.0 4 35.9855 37.0 37.0 37.0 37.0 37.0 5 36.0245 37.0 37.0 37.0 37.0 37.0 6 35.928 37.0 37.0 37.0 37.0 37.0 7 35.9075 37.0 37.0 37.0 37.0 37.0 8 35.943 37.0 37.0 37.0 37.0 37.0 9 35.95 37.0 37.0 37.0 37.0 37.0 10-11 35.97025 37.0 37.0 37.0 37.0 37.0 12-13 35.99275 37.0 37.0 37.0 37.0 37.0 14-15 35.905 37.0 37.0 37.0 37.0 37.0 16-17 35.90325 37.0 37.0 37.0 37.0 37.0 18-19 35.918499999999995 37.0 37.0 37.0 37.0 37.0 20-21 35.83275 37.0 37.0 37.0 37.0 37.0 22-23 35.79875 37.0 37.0 37.0 37.0 37.0 24-25 35.84625 37.0 37.0 37.0 37.0 37.0 26-27 35.71625 37.0 37.0 37.0 37.0 37.0 28-29 35.752250000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.67375 37.0 37.0 37.0 37.0 37.0 32-33 35.647000000000006 37.0 37.0 37.0 37.0 37.0 34-35 35.587 37.0 37.0 37.0 37.0 37.0 36-37 35.723749999999995 37.0 37.0 37.0 37.0 37.0 38-39 35.74 37.0 37.0 37.0 37.0 37.0 40-41 35.763000000000005 37.0 37.0 37.0 37.0 37.0 42-43 35.741249999999994 37.0 37.0 37.0 37.0 37.0 44-45 35.566 37.0 37.0 37.0 37.0 37.0 46-47 35.6745 37.0 37.0 37.0 37.0 37.0 48-49 35.55175 37.0 37.0 37.0 37.0 37.0 50-51 35.566500000000005 37.0 37.0 37.0 37.0 37.0 52-53 35.6135 37.0 37.0 37.0 37.0 37.0 54-55 35.57275 37.0 37.0 37.0 37.0 37.0 56-57 35.5795 37.0 37.0 37.0 37.0 37.0 58-59 35.54875 37.0 37.0 37.0 37.0 37.0 60-61 35.66025 37.0 37.0 37.0 37.0 37.0 62-63 35.63675 37.0 37.0 37.0 37.0 37.0 64-65 35.57325 37.0 37.0 37.0 37.0 37.0 66-67 35.5685 37.0 37.0 37.0 37.0 37.0 68-69 35.611000000000004 37.0 37.0 37.0 37.0 37.0 70-71 35.744 37.0 37.0 37.0 37.0 37.0 72-73 35.59764941235309 37.0 37.0 37.0 37.0 37.0 74-75 35.48137034258565 37.0 37.0 37.0 37.0 37.0 76-77 35.57672103118326 37.0 37.0 37.0 37.0 37.0 78-79 35.55702851425713 37.0 37.0 37.0 37.0 37.0 80-81 35.4552276138069 37.0 37.0 37.0 37.0 37.0 82-83 35.52376188094047 37.0 37.0 37.0 37.0 37.0 84-85 35.51975987993997 37.0 37.0 37.0 37.0 37.0 86-87 35.41545772886443 37.0 37.0 37.0 31.0 37.0 88-89 35.40520260130065 37.0 37.0 37.0 37.0 37.0 90-91 35.43246623311656 37.0 37.0 37.0 37.0 37.0 92-93 35.4319659829915 37.0 37.0 37.0 37.0 37.0 94-95 35.398699349674835 37.0 37.0 37.0 37.0 37.0 96-97 35.37284705275677 37.0 37.0 37.0 37.0 37.0 98-99 35.34345109189988 37.0 37.0 37.0 31.0 37.0 100-101 35.260125625608126 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 1.0 24 4.0 25 2.0 26 10.0 27 18.0 28 26.0 29 46.0 30 64.0 31 98.0 32 125.0 33 160.0 34 300.0 35 523.0 36 2119.0 37 501.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.924999999999997 14.025000000000002 16.975 42.075 2 25.224999999999998 18.825 30.25 25.7 3 26.924999999999997 19.8 24.725 28.549999999999997 4 27.474999999999998 25.474999999999998 19.2 27.85 5 26.85 30.825000000000003 21.2 21.125 6 22.425 32.7 20.875 24.0 7 20.3 20.150000000000002 37.2 22.35 8 20.875 23.225 27.425 28.475 9 22.0 21.025 28.4 28.575 10-11 24.275 30.612499999999997 21.025 24.087500000000002 12-13 23.275000000000002 23.849999999999998 26.125 26.75 14-15 23.5375 25.162499999999998 25.874999999999996 25.424999999999997 16-17 24.9125 25.674999999999997 25.162499999999998 24.25 18-19 23.7 26.674999999999997 24.65 24.975 20-21 23.325000000000003 25.674999999999997 25.8 25.2 22-23 23.3625 26.337500000000002 24.675 25.624999999999996 24-25 24.462500000000002 26.8 24.55 24.1875 26-27 24.1375 26.137500000000003 25.0125 24.712500000000002 28-29 24.1125 25.0375 24.5625 26.2875 30-31 23.6375 25.2375 25.0625 26.0625 32-33 23.4875 25.224999999999998 25.874999999999996 25.412499999999998 34-35 22.95 26.787499999999998 24.85 25.412499999999998 36-37 23.150000000000002 26.9625 24.85 25.0375 38-39 24.6125 24.65 25.2875 25.45 40-41 24.6125 25.937500000000004 24.325 25.124999999999996 42-43 24.337500000000002 25.1875 25.4875 24.9875 44-45 24.462500000000002 25.75 24.15 25.637500000000003 46-47 23.2125 25.912499999999998 25.124999999999996 25.75 48-49 23.7 25.7125 25.587500000000002 25.0 50-51 24.2 25.0375 25.75 25.0125 52-53 24.2 25.424999999999997 26.25 24.125 54-55 24.462500000000002 25.087500000000002 25.2875 25.162499999999998 56-57 24.6625 26.0 24.2875 25.05 58-59 24.3 25.224999999999998 25.0375 25.4375 60-61 24.5375 24.5375 24.925 26.0 62-63 23.625 26.5375 24.5375 25.3 64-65 24.8 25.162499999999998 24.9125 25.124999999999996 66-67 23.5875 25.162499999999998 26.087500000000002 25.162499999999998 68-69 25.137500000000003 25.2625 24.15 25.45 70-71 24.637500000000003 25.674999999999997 24.625 25.0625 72-73 24.18104526131533 25.28132033008252 25.581395348837212 24.956239059764943 74-75 24.20605151287822 26.069017254313575 24.33108277069267 25.393848462115532 76-77 24.384144054020258 25.30949105914718 25.372014505439537 24.934350381393024 78-79 24.787393696848426 24.987493746873437 24.68734367183592 25.53776888444222 80-81 25.287643821910955 25.812906453226613 24.23711855927964 24.662331165582792 82-83 23.67433716858429 25.237618809404704 25.737868934467233 25.350175087543768 84-85 24.049524762381193 25.6128064032016 25.30015007503752 25.03751875937969 86-87 24.324662331165584 25.57528764382191 24.437218609304654 25.662831415707853 88-89 25.050025012506254 25.11255627813907 25.52526263131566 24.312156078039017 90-91 24.462231115557778 25.925462731365684 24.81240620310155 24.79989994997499 92-93 23.949474737368686 25.45022511255628 25.512756378189096 25.087543771885944 94-95 24.487243621810904 25.137568784392194 24.824912456228116 25.550275137568786 96-97 24.301990734944283 25.12833354200576 25.015650431951926 25.554025291098036 98-99 24.21666878092097 24.457693771406824 26.094126601547636 25.23151084612457 100-101 25.458860759493675 11.503164556962025 31.25 31.787974683544302 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 1.0 27 2.5 28 5.0 29 4.5 30 6.0 31 13.0 32 17.5 33 21.0 34 31.0 35 45.5 36 55.5 37 71.0 38 85.0 39 101.5 40 120.5 41 146.0 42 177.0 43 187.0 44 192.5 45 203.0 46 196.0 47 185.0 48 180.0 49 169.0 50 157.5 51 139.5 52 124.0 53 120.0 54 115.0 55 103.0 56 77.5 57 68.0 58 78.5 59 73.5 60 70.5 61 63.5 62 49.5 63 53.5 64 60.5 65 57.5 66 52.0 67 41.5 68 41.0 69 44.0 70 39.5 71 34.0 72 28.0 73 25.0 74 19.5 75 14.0 76 10.0 77 8.5 78 7.0 79 2.5 80 2.0 81 3.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 9.0 97 20.0 98 55.0 99 271.0 100 966.0 101 2677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.50961538461539 87.52499999999999 2 6.143162393162393 11.5 3 0.3472222222222222 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485703 spots for SRR21853459.sra Written 485703 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra Read 485689 spots for SRR21853459.sra Written 485689 spots for SRR21853459.sra SRR ids: ['SRR21853459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ena_tray SRR21853459.sra spots: 9713794 blocks: [[1, 485689], [485690, 971378], [971379, 1457067], [1457068, 1942756], [1942757, 2428445], [2428446, 2914134], [2914135, 3399823], [3399824, 3885512], [3885513, 4371201], [4371202, 4856890], [4856891, 5342579], [5342580, 5828268], [5828269, 6313957], [6313958, 6799646], [6799647, 7285335], [7285336, 7771024], [7771025, 8256713], [8256714, 8742402], [8742403, 9228091], [9228092, 9713794]] SRR21853459 file size 2611686 SRR21853459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853459 SRR21853459_1.fastq Input file: SRR21853459_1.fastq trimmed: SRR21853459-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:19:22 2024 >> started Fri Dec 6 15:19:31 2024 >> done (8.809s) 9713794 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 3143 ( 0.03%) empty reads filtered out after trimming by size control 9710648 (99.97%) reads available; of these: 349 ( 0.00%) trimmed reads available after processing 9710299 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 22 3 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 4 0.00% 32 7 0.00% 33 10 0.00% 34 3 0.00% 35 22 0.00% 36 20 0.00% 37 31 0.00% 38 14 0.00% 39 21 0.00% 40 24 0.00% 41 18 0.00% 42 22 0.00% 43 30 0.00% 44 18 0.00% 45 25 0.00% 46 38 0.00% 47 22 0.00% 48 25 0.00% 49 28 0.00% 50 34 0.00% 51 24 0.00% 52 22 0.00% 53 54 0.00% 54 31 0.00% 55 42 0.00% 56 34 0.00% 57 37 0.00% 58 44 0.00% 59 41 0.00% 60 44 0.00% 61 43 0.00% 62 48 0.00% 63 48 0.00% 64 47 0.00% 65 59 0.00% 66 52 0.00% 67 40 0.00% 68 45 0.00% 69 55 0.00% 70 61 0.00% 71 65 0.00% 72 54 0.00% 73 55 0.00% 74 50 0.00% 75 70 0.00% 76 83 0.00% 77 94 0.00% 78 74 0.00% 79 76 0.00% 80 87 0.00% 81 82 0.00% 82 83 0.00% 83 98 0.00% 84 86 0.00% 85 102 0.00% 86 120 0.00% 87 98 0.00% 88 135 0.00% 89 134 0.00% 90 179 0.00% 91 420 0.00% 92 173 0.00% 93 221 0.00% 94 565 0.01% 95 2117 0.02% 96 12753 0.13% 97 48450 0.50% 98 182140 1.88% 99 651868 6.71% 100 2310132 23.79% 101 6498683 66.92% 9710648 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=19 prefix-density=0.27 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=6.65 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.3 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 15:19:52 Started mapping on | Dec 06 15:19:52 Finished on | Dec 06 15:20:09 Mapping speed, Million of reads per hour | 2056.37 Number of input reads | 9710648 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8494052 Uniquely mapped reads % | 87.47% Average mapped length | 100.21 Number of splices: Total | 3062281 Number of splices: Annotated (sjdb) | 2896578 Number of splices: GT/AG | 3018012 Number of splices: GC/AG | 38212 Number of splices: AT/AC | 1738 Number of splices: Non-canonical | 4319 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.22 Insertion rate per base | 0.01% Insertion average length | 1.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 520250 % of reads mapped to multiple loci | 5.36% Number of reads mapped to too many loci | 399153 % of reads mapped to too many loci | 4.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 696346 696346 696346 N_multimapping 520250 520250 520250 N_noFeature 514489 4594461 4299733 N_ambiguous 133040 8542 11040 UnstrandedReadsAssigned:7846523 PositiveStrandReadsAssigned:3891049 NegativeStrandReadsAssigned:4183279 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853459 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853459-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,710,648 reads, 8,178,047 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52973 SRR21853459.ke.tsv 35125 SRR21853459.se.tsv 88098 total ==> SRR21853459.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 42.8496 10.1557 PNS24249 1928 1829 56.4096 6.90774 PNS24246 1044 945 42.8496 10.1557 PNS24248 1044 945 42.8496 10.1557 PNS24244 1471 1372 31.0417 5.06744 PNS24243 293 194 14 16.163 KQK14069 1603 1504 4715.75 702.262 KQK14071 474 375 496.75 296.69 ==> SRR21853459.se.tsv <== BRADI_1g14170v3 5896 BRADI_1g53295v3 99 BRADI_1g59795v3 248 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 658 BRADI_1g74790v3 94 BRADI_1g09890v3 3 BRADI_1g77505v3 142 BRADI_1g48960v3 0 SRR21853459 completed mapping pipeline successfully