Starting /dee2/code/volunteer_pipeline.sh SRR21853460 current disk space = 1550338486272 free memory = 1593865420 SRR21853460 SRAfilesize 8e21d934b60596df0ef98851b63b5588 SRR21853460.sra SRR21853460.sra file validated SRR21853460 is single end SRR21853460 is conventional basespace SRR21853460 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2265 37.0 37.0 37.0 37.0 37.0 2 35.03375 37.0 37.0 37.0 25.0 37.0 3 35.5055 37.0 37.0 37.0 37.0 37.0 4 35.4705 37.0 37.0 37.0 37.0 37.0 5 35.719 37.0 37.0 37.0 37.0 37.0 6 35.7035 37.0 37.0 37.0 37.0 37.0 7 35.628 37.0 37.0 37.0 37.0 37.0 8 35.7765 37.0 37.0 37.0 37.0 37.0 9 35.905 37.0 37.0 37.0 37.0 37.0 10-11 35.7825 37.0 37.0 37.0 37.0 37.0 12-13 35.8745 37.0 37.0 37.0 37.0 37.0 14-15 35.82275 37.0 37.0 37.0 37.0 37.0 16-17 35.771 37.0 37.0 37.0 37.0 37.0 18-19 35.843500000000006 37.0 37.0 37.0 37.0 37.0 20-21 35.718500000000006 37.0 37.0 37.0 37.0 37.0 22-23 35.6725 37.0 37.0 37.0 37.0 37.0 24-25 35.6555 37.0 37.0 37.0 37.0 37.0 26-27 35.692 37.0 37.0 37.0 37.0 37.0 28-29 35.62325 37.0 37.0 37.0 37.0 37.0 30-31 35.54425 37.0 37.0 37.0 37.0 37.0 32-33 35.50375 37.0 37.0 37.0 37.0 37.0 34-35 35.702 37.0 37.0 37.0 37.0 37.0 36-37 35.74674674674675 37.0 37.0 37.0 37.0 37.0 38-39 35.57557557557558 37.0 37.0 37.0 37.0 37.0 40-41 35.571071071071074 37.0 37.0 37.0 37.0 37.0 42-43 35.59009009009009 37.0 37.0 37.0 37.0 37.0 44-45 35.55755755755756 37.0 37.0 37.0 37.0 37.0 46-47 35.47822822822823 37.0 37.0 37.0 37.0 37.0 48-49 35.47397397397397 37.0 37.0 37.0 37.0 37.0 50-51 35.53378378378378 37.0 37.0 37.0 37.0 37.0 52-53 35.56070087609512 37.0 37.0 37.0 37.0 37.0 54-55 35.53917396745932 37.0 37.0 37.0 37.0 37.0 56-57 35.43003754693367 37.0 37.0 37.0 37.0 37.0 58-59 35.53116395494368 37.0 37.0 37.0 37.0 37.0 60-61 35.564205256570716 37.0 37.0 37.0 37.0 37.0 62-63 35.44780976220275 37.0 37.0 37.0 37.0 37.0 64-65 35.48961201501877 37.0 37.0 37.0 37.0 37.0 66-67 35.48060075093868 37.0 37.0 37.0 37.0 37.0 68-69 35.45487837513467 37.0 37.0 37.0 37.0 37.0 70-71 35.37014775857752 37.0 37.0 37.0 37.0 37.0 72-73 35.34184823441022 37.0 37.0 37.0 37.0 37.0 74-75 35.32442854890438 37.0 37.0 37.0 31.0 37.0 76-77 35.28695996174395 37.0 37.0 37.0 31.0 37.0 78-79 35.31286036600652 37.0 37.0 37.0 31.0 37.0 80-81 35.46760449309825 37.0 37.0 37.0 37.0 37.0 82-83 35.43974181770634 37.0 37.0 37.0 37.0 37.0 84-85 35.326006850488525 37.0 37.0 37.0 37.0 37.0 86-87 35.317348732111476 37.0 37.0 37.0 37.0 37.0 88-89 35.270467101958815 37.0 37.0 37.0 37.0 37.0 90-91 35.322327790674045 37.0 37.0 37.0 31.0 37.0 92-93 35.31618883109981 37.0 37.0 37.0 31.0 37.0 94-95 35.208949568489345 37.0 37.0 37.0 25.0 37.0 96-97 35.178349468029005 37.0 37.0 37.0 25.0 37.0 98-99 35.32594013163465 37.0 37.0 37.0 31.0 37.0 100-101 35.111861413412385 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 5.0 25 10.0 26 7.0 27 22.0 28 31.0 29 43.0 30 69.0 31 105.0 32 155.0 33 201.0 34 292.0 35 549.0 36 2122.0 37 383.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.714357178589296 14.7823911955978 15.507753876938468 40.995497748874435 2 24.286796263569805 19.919212320121183 29.63898005554153 26.15501136076748 3 26.863431715857928 20.58529264632316 23.23661830915458 29.314657328664335 4 28.53926963481741 24.73736868434217 18.959479739869938 27.763881940970485 5 28.66433216608304 27.51375687843922 22.486243121560783 21.335667833916958 6 24.362181090545274 31.81590795397699 20.66033016508254 23.1615807903952 7 22.26113056528264 19.28464232116058 35.51775887943972 22.936468234117058 8 22.786393196598297 22.936468234117058 25.437718859429715 28.83941970985493 9 21.635817908954476 21.635817908954476 29.064532266133064 27.66383191595798 10-11 24.862431215607803 28.51425712856428 21.285642821410704 25.337668834417208 12-13 24.474737368684345 23.24912456228114 25.57528764382191 26.700850425212607 14-15 24.337168584292147 24.437218609304654 25.437718859429715 25.78789394697349 16-17 25.350175087543768 24.987493746873437 24.212106053026513 25.45022511255628 18-19 24.562281140570285 25.337668834417208 24.88744372186093 25.212606303151574 20-21 25.57528764382191 24.249624812406203 25.312656328164078 24.862431215607803 22-23 24.6248124062031 24.787393696848426 25.18759379689845 25.400200100050025 24-25 24.64982491245623 24.212106053026513 25.050025012506254 26.088044022011005 26-27 24.537268634317158 25.125062531265634 25.26263131565783 25.07503751875938 28-29 25.45022511255628 25.050025012506254 23.724362181090545 25.775387693846923 30-31 24.7623811905953 24.512256128064035 24.937468734367183 25.78789394697349 32-33 25.48774387193597 24.12456228114057 24.474737368684345 25.912956478239117 34-35 25.512756378189096 24.524762381190595 23.92446223111556 26.038019009504755 36-37 23.84884884884885 25.125125125125123 25.212712712712715 25.813313313313312 38-39 24.336836836836838 25.95095095095095 24.14914914914915 25.563063063063062 40-41 25.237737737737735 24.236736736736734 25.012512512512515 25.513013013013015 42-43 24.824824824824827 24.512012012012015 25.13763763763764 25.525525525525527 44-45 25.16266266266266 23.736236236236234 24.93743743743744 26.163663663663662 46-47 24.64964964964965 24.6996996996997 24.486986986986985 26.163663663663662 48-49 23.96146146146146 25.08758758758759 25.025025025025027 25.925925925925924 50-51 26.13863863863864 24.724724724724727 24.7997997997998 24.336836836836838 52-53 24.90613266583229 24.39299123904881 24.568210262828536 26.132665832290364 54-55 24.90613266583229 25.106382978723403 24.055068836045056 25.93241551939925 56-57 24.505632040050063 24.06758448060075 26.0450563204005 25.381727158948685 58-59 25.1188986232791 24.380475594493117 25.219023779724658 25.281602002503128 60-61 25.256570713391742 25.056320400500624 24.718397997496872 24.96871088861076 62-63 24.918648310387987 24.943679599499376 25.33166458072591 24.80600750938673 64-65 25.732165206508135 24.480600750938674 24.918648310387987 24.868585732165208 66-67 26.157697121401753 24.44305381727159 23.979974968710888 25.41927409261577 68-69 25.14707723119289 24.433596194767805 25.272249342846415 25.14707723119289 70-71 25.79514149762084 24.993739043325817 23.6664162283997 25.544703230653642 72-73 25.494615577260205 24.693213122965187 24.254946155772604 25.557225144002004 74-75 25.554302893649005 25.015658273831892 24.865338845045724 24.564699987473382 76-77 25.288220551378448 24.3734335839599 25.225563909774433 25.112781954887218 78-79 25.156680872399097 25.018801704687892 25.156680872399097 24.667836550513915 80-81 25.072082236429736 24.558104550582925 25.297730976557602 25.072082236429736 82-83 25.636523266022827 24.645679167189265 25.222626363978428 24.49517120280948 84-85 24.369431547245576 24.695695821307567 24.95921696574225 25.975655665704604 86-87 24.441375847351242 24.66733617875973 24.554356013055486 26.336931960833542 88-89 26.582119537920647 24.13360120542441 25.226017076845807 24.05826217980914 90-91 25.461625423941715 24.393920361763595 24.921492274839842 25.22296193945484 92-93 25.64457300968432 24.21079109545969 24.915105018236698 25.229530876619293 94-95 24.93705941591138 25.13846928499496 24.87411883182276 25.050352467270898 96-97 24.43267776096823 24.84871406959153 25.504286434694905 25.214321734745337 98-99 25.65150740929995 24.284619315278487 24.68063362289218 25.383239652529383 100-101 26.1455525606469 10.908514349135881 30.807039797050894 32.13889329316632 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 1.0 28 1.5 29 3.0 30 6.0 31 7.5 32 15.0 33 21.5 34 21.5 35 28.5 36 40.5 37 60.0 38 75.0 39 77.5 40 101.0 41 134.5 42 159.0 43 166.5 44 169.0 45 178.5 46 188.0 47 190.5 48 180.0 49 179.5 50 159.0 51 142.5 52 141.0 53 136.5 54 131.5 55 125.0 56 107.5 57 79.5 58 73.0 59 72.0 60 70.5 61 70.0 62 63.0 63 62.0 64 63.0 65 52.0 66 47.0 67 53.0 68 51.5 69 45.0 70 36.0 71 30.5 72 36.5 73 32.5 74 20.0 75 17.5 76 16.5 77 15.5 78 12.5 79 8.0 80 5.5 81 5.0 82 4.0 83 1.0 84 2.0 85 2.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.975 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 4.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 2.0 70-71 0.0 72-73 1.0 74-75 1.0 76-77 2.0 78-79 0.0 80-81 2.0 82-83 2.0 84-85 2.0 86-87 1.0 88-89 1.0 90-91 5.0 92-93 3.0 94-95 4.0 96-97 22.0 98-99 323.0 100-101 3624.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97494001599573 88.125 2 5.545187949880033 10.4 3 0.4265529192215409 1.2 4 0.026659557451346308 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026659557451346308 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655334 spots for SRR21853460.sra Written 655334 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra Read 655333 spots for SRR21853460.sra Written 655333 spots for SRR21853460.sra SRR ids: ['SRR21853460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cm_9xm2x SRR21853460.sra spots: 13106661 blocks: [[1, 655333], [655334, 1310666], [1310667, 1965999], [1966000, 2621332], [2621333, 3276665], [3276666, 3931998], [3931999, 4587331], [4587332, 5242664], [5242665, 5897997], [5897998, 6553330], [6553331, 7208663], [7208664, 7863996], [7863997, 8519329], [8519330, 9174662], [9174663, 9829995], [9829996, 10485328], [10485329, 11140661], [11140662, 11795994], [11795995, 12451327], [12451328, 13106661]] SRR21853460 file size 3521402 SRR21853460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853460 SRR21853460_1.fastq Input file: SRR21853460_1.fastq trimmed: SRR21853460-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:19:24 2024 >> started Fri Dec 6 15:19:39 2024 >> done (15.845s) 13106661 reads processed; of these: 64 ( 0.00%) short reads filtered out after trimming by size control 62412 ( 0.48%) empty reads filtered out after trimming by size control 13044185 (99.52%) reads available; of these: 601 ( 0.00%) trimmed reads available after processing 13043584 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 6 0.00% 21 8 0.00% 22 7 0.00% 23 5 0.00% 24 6 0.00% 25 6 0.00% 26 9 0.00% 27 10 0.00% 28 4 0.00% 29 8 0.00% 30 11 0.00% 31 4 0.00% 32 12 0.00% 33 4 0.00% 34 7 0.00% 35 267 0.00% 36 317 0.00% 37 281 0.00% 38 271 0.00% 39 308 0.00% 40 318 0.00% 41 330 0.00% 42 365 0.00% 43 313 0.00% 44 340 0.00% 45 331 0.00% 46 335 0.00% 47 434 0.00% 48 434 0.00% 49 435 0.00% 50 486 0.00% 51 490 0.00% 52 575 0.00% 53 573 0.00% 54 534 0.00% 55 621 0.00% 56 619 0.00% 57 647 0.00% 58 707 0.01% 59 830 0.01% 60 848 0.01% 61 1006 0.01% 62 992 0.01% 63 1078 0.01% 64 1015 0.01% 65 1071 0.01% 66 1151 0.01% 67 1239 0.01% 68 1321 0.01% 69 1478 0.01% 70 1662 0.01% 71 1778 0.01% 72 2031 0.02% 73 2161 0.02% 74 2182 0.02% 75 2101 0.02% 76 2208 0.02% 77 2396 0.02% 78 2379 0.02% 79 2642 0.02% 80 3003 0.02% 81 3313 0.03% 82 3551 0.03% 83 3857 0.03% 84 4130 0.03% 85 4252 0.03% 86 4460 0.03% 87 4369 0.03% 88 4444 0.03% 89 5120 0.04% 90 5308 0.04% 91 6537 0.05% 92 6733 0.05% 93 7484 0.06% 94 7699 0.06% 95 9929 0.08% 96 24096 0.18% 97 70130 0.54% 98 245200 1.88% 99 873466 6.70% 100 2994937 22.96% 101 8708145 66.76% 13044185 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.24 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=12.52 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=2.7 sequence=ATCAGTGAGCTGCTGTTTAGGCCTTGCCGGACTCCTC Started job on | Dec 06 15:19:57 Started mapping on | Dec 06 15:19:57 Finished on | Dec 06 15:20:18 Mapping speed, Million of reads per hour | 2236.15 Number of input reads | 13044185 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11255129 Uniquely mapped reads % | 86.28% Average mapped length | 100.05 Number of splices: Total | 3986057 Number of splices: Annotated (sjdb) | 3772487 Number of splices: GT/AG | 3926810 Number of splices: GC/AG | 49861 Number of splices: AT/AC | 2258 Number of splices: Non-canonical | 7128 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 796522 % of reads mapped to multiple loci | 6.11% Number of reads mapped to too many loci | 736470 % of reads mapped to too many loci | 5.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.28% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 992534 992534 992534 N_multimapping 796522 796522 796522 N_noFeature 628877 5866188 5870545 N_ambiguous 173488 14273 13065 UnstrandedReadsAssigned:10452764 PositiveStrandReadsAssigned:5374668 NegativeStrandReadsAssigned:5371519 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853460 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853460-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,044,185 reads, 10,957,569 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,277 rounds 52973 SRR21853460.ke.tsv 35125 SRR21853460.se.tsv 88098 total ==> SRR21853460.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 51.1675 8.70664 PNS24249 1928 1829 114.368 10.0549 PNS24246 1044 945 51.1675 8.70664 PNS24248 1044 945 51.1675 8.70664 PNS24244 1471 1372 19.1296 2.24203 PNS24243 293 194 11 9.11757 KQK14069 1603 1504 6369.66 681.014 KQK14071 474 375 861.142 369.259 ==> SRR21853460.se.tsv <== BRADI_1g14170v3 8079 BRADI_1g53295v3 102 BRADI_1g59795v3 318 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 839 BRADI_1g74790v3 107 BRADI_1g09890v3 4 BRADI_1g77505v3 186 BRADI_1g48960v3 0 SRR21853460 completed mapping pipeline successfully