Starting /dee2/code/volunteer_pipeline.sh SRR21853461 current disk space = 1550417031168 free memory = 1603414152 SRR21853461 SRAfilesize f64a1fe1b487d9e944d3847dd8a8278f SRR21853461.sra SRR21853461.sra file validated SRR21853461 is single end SRR21853461 is conventional basespace SRR21853461 read1 length is 78-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 78-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.112 37.0 37.0 37.0 25.0 37.0 2 34.8735 37.0 37.0 37.0 25.0 37.0 3 35.4765 37.0 37.0 37.0 37.0 37.0 4 35.6585 37.0 37.0 37.0 37.0 37.0 5 35.7245 37.0 37.0 37.0 37.0 37.0 6 35.71 37.0 37.0 37.0 37.0 37.0 7 35.6585 37.0 37.0 37.0 37.0 37.0 8 35.8045 37.0 37.0 37.0 37.0 37.0 9 35.858 37.0 37.0 37.0 37.0 37.0 10-11 35.81125 37.0 37.0 37.0 37.0 37.0 12-13 35.79025 37.0 37.0 37.0 37.0 37.0 14-15 35.8195 37.0 37.0 37.0 37.0 37.0 16-17 35.793 37.0 37.0 37.0 37.0 37.0 18-19 35.74 37.0 37.0 37.0 37.0 37.0 20-21 35.72675 37.0 37.0 37.0 37.0 37.0 22-23 35.772999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.653999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.659499999999994 37.0 37.0 37.0 37.0 37.0 28-29 35.67275 37.0 37.0 37.0 37.0 37.0 30-31 35.5945 37.0 37.0 37.0 37.0 37.0 32-33 35.559749999999994 37.0 37.0 37.0 37.0 37.0 34-35 35.531 37.0 37.0 37.0 37.0 37.0 36-37 35.6345 37.0 37.0 37.0 37.0 37.0 38-39 35.462999999999994 37.0 37.0 37.0 37.0 37.0 40-41 35.521249999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.479 37.0 37.0 37.0 37.0 37.0 44-45 35.46625 37.0 37.0 37.0 37.0 37.0 46-47 35.391000000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.3795 37.0 37.0 37.0 37.0 37.0 50-51 35.287 37.0 37.0 37.0 31.0 37.0 52-53 35.495999999999995 37.0 37.0 37.0 37.0 37.0 54-55 35.4255 37.0 37.0 37.0 37.0 37.0 56-57 35.42725 37.0 37.0 37.0 37.0 37.0 58-59 35.29774999999999 37.0 37.0 37.0 31.0 37.0 60-61 35.40975 37.0 37.0 37.0 37.0 37.0 62-63 35.357 37.0 37.0 37.0 37.0 37.0 64-65 35.32025 37.0 37.0 37.0 37.0 37.0 66-67 35.239999999999995 37.0 37.0 37.0 25.0 37.0 68-69 35.21625 37.0 37.0 37.0 31.0 37.0 70-71 35.11825 37.0 37.0 37.0 25.0 37.0 72-73 35.24675 37.0 37.0 37.0 31.0 37.0 74-75 35.289249999999996 37.0 37.0 37.0 31.0 37.0 76-77 35.25425 37.0 37.0 37.0 37.0 37.0 78-79 35.29729457364341 37.0 37.0 37.0 31.0 37.0 80-81 35.2145536384096 37.0 37.0 37.0 31.0 37.0 82-83 35.221055263815956 37.0 37.0 37.0 31.0 37.0 84-85 35.31357839459865 37.0 37.0 37.0 37.0 37.0 86-87 35.19804951237809 37.0 37.0 37.0 31.0 37.0 88-89 35.25359047365643 37.0 37.0 37.0 31.0 37.0 90-91 35.15432716358179 37.0 37.0 37.0 25.0 37.0 92-93 35.124812406203105 37.0 37.0 37.0 25.0 37.0 94-95 35.085792896448226 37.0 37.0 37.0 25.0 37.0 96-97 35.15078140574046 37.0 37.0 37.0 25.0 37.0 98-99 35.056249266000414 37.0 37.0 37.0 25.0 37.0 100-101 35.182617958012315 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 5.0 24 5.0 25 9.0 26 19.0 27 22.0 28 36.0 29 54.0 30 80.0 31 112.0 32 141.0 33 186.0 34 293.0 35 555.0 36 2129.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.175000000000004 13.825000000000001 18.224999999999998 36.775000000000006 2 26.82370820668693 19.858156028368796 30.724417426545088 22.593718338399192 3 26.525 23.825 24.474999999999998 25.174999999999997 4 26.474999999999998 29.099999999999998 18.675 25.75 5 27.775 32.6 19.2 20.424999999999997 6 22.125 33.800000000000004 20.375 23.7 7 21.05 15.825 38.3 24.825 8 22.075 21.325 24.325 32.275 9 20.849999999999998 21.275 29.549999999999997 28.325 10-11 25.825 27.787499999999998 19.2625 27.125 12-13 24.325 22.525000000000002 26.400000000000002 26.75 14-15 23.7 24.1125 25.4875 26.700000000000003 16-17 25.4625 25.0 24.0625 25.474999999999998 18-19 24.0375 25.2625 25.2125 25.4875 20-21 25.474999999999998 25.362499999999997 23.4625 25.7 22-23 24.65 24.975 24.5625 25.8125 24-25 24.5125 24.8625 24.887500000000003 25.7375 26-27 24.0625 25.8625 23.6625 26.4125 28-29 25.387500000000003 24.712500000000002 24.15 25.75 30-31 25.137500000000003 24.5625 24.2875 26.0125 32-33 24.9875 25.45 24.175 25.387500000000003 34-35 24.2625 25.4625 23.925 26.35 36-37 24.2375 25.05 24.5375 26.174999999999997 38-39 25.4625 24.375 24.15 26.0125 40-41 24.65 25.0375 23.825 26.487500000000004 42-43 24.5375 25.1875 24.1375 26.137500000000003 44-45 25.087500000000002 24.25 24.099999999999998 26.5625 46-47 25.275 24.85 24.2625 25.6125 48-49 25.0625 25.087500000000002 24.5375 25.3125 50-51 25.15 25.2875 24.349999999999998 25.2125 52-53 24.462500000000002 23.474999999999998 24.6 27.462500000000002 54-55 24.425 24.0 25.0375 26.5375 56-57 26.3 23.8625 24.425 25.412499999999998 58-59 25.124999999999996 25.2875 23.5875 26.0 60-61 26.2125 25.174999999999997 23.4625 25.15 62-63 24.85 24.625 25.074999999999996 25.45 64-65 25.2375 24.725 24.4875 25.55 66-67 25.1 25.45 24.1875 25.2625 68-69 26.4125 24.925 22.975 25.687500000000004 70-71 25.3125 25.837500000000002 24.0375 24.8125 72-73 26.187500000000004 24.925 23.4375 25.45 74-75 24.5125 25.2875 23.8625 26.337500000000002 76-77 26.0625 24.025 24.2875 25.624999999999996 78-79 25.19064883110389 24.440555069383674 24.678084760595073 25.690711338917367 80-81 25.668917229307326 24.293573393348336 24.093523380845213 25.943985996499126 82-83 26.644161040260066 24.55613903475869 23.393348337084273 25.406351587896975 84-85 24.868717179294826 24.731182795698924 24.681170292573142 25.71892973243311 86-87 25.906476619154787 24.48112028007002 23.63090772693173 25.98149537384346 88-89 24.52169563586345 24.58421908215581 24.334125296986368 26.559959984994375 90-91 24.84992496248124 24.574787393696848 23.949474737368686 26.625812906453227 92-93 26.088044022011005 25.287643821910955 23.961980990495245 24.662331165582792 94-95 25.012506253126567 25.100050025012504 23.59929964982491 26.28814407203602 96-97 25.41311967951928 24.636955433149723 23.985978968452677 25.963945918878316 98-99 26.090273363000637 23.280356007628736 24.272091544818817 26.35727908455181 100-101 26.984877126654066 10.727788279773156 29.741650913673602 32.54568367989918 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.5 26 2.5 27 1.5 28 4.5 29 5.5 30 6.0 31 9.5 32 11.0 33 15.5 34 25.5 35 33.0 36 42.0 37 53.5 38 74.0 39 101.5 40 123.5 41 133.0 42 134.0 43 152.5 44 169.0 45 184.0 46 184.0 47 181.0 48 174.0 49 142.0 50 132.5 51 140.5 52 135.0 53 125.0 54 119.0 55 109.5 56 93.0 57 88.0 58 84.5 59 69.0 60 69.5 61 74.0 62 74.0 63 70.0 64 66.5 65 58.5 66 60.5 67 65.0 68 55.5 69 50.5 70 46.0 71 43.0 72 41.0 73 40.0 74 34.0 75 26.0 76 19.0 77 11.5 78 10.5 79 9.0 80 5.5 81 3.0 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 8.0 97 21.0 98 73.0 99 275.0 100 894.0 101 2727.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.53459791611007 87.52499999999999 2 6.198236708522575 11.600000000000001 3 0.18701576275714668 0.525 4 0.05343307507347048 0.2 5 0.0 0.0 6 0.02671653753673524 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 6 0.15 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707670 spots for SRR21853461.sra Written 707670 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra Read 707659 spots for SRR21853461.sra Written 707659 spots for SRR21853461.sra SRR ids: ['SRR21853461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xsctr53c SRR21853461.sra spots: 14153191 blocks: [[1, 707659], [707660, 1415318], [1415319, 2122977], [2122978, 2830636], [2830637, 3538295], [3538296, 4245954], [4245955, 4953613], [4953614, 5661272], [5661273, 6368931], [6368932, 7076590], [7076591, 7784249], [7784250, 8491908], [8491909, 9199567], [9199568, 9907226], [9907227, 10614885], [10614886, 11322544], [11322545, 12030203], [12030204, 12737862], [12737863, 13445521], [13445522, 14153191]] SRR21853461 file size 3809989 SRR21853461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853461 SRR21853461_1.fastq Input file: SRR21853461_1.fastq trimmed: SRR21853461-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:23:12 2024 >> started Fri Dec 6 15:23:19 2024 >> done (7.209s) 14153191 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 26183 ( 0.18%) empty reads filtered out after trimming by size control 14126998 (99.81%) reads available; of these: 264 ( 0.00%) trimmed reads available after processing 14126734 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 3 0.00% 29 3 0.00% 30 2 0.00% 31 1 0.00% 32 5 0.00% 33 5 0.00% 34 6 0.00% 35 50 0.00% 36 44 0.00% 37 54 0.00% 38 45 0.00% 39 49 0.00% 40 43 0.00% 41 37 0.00% 42 55 0.00% 43 51 0.00% 44 54 0.00% 45 35 0.00% 46 52 0.00% 47 45 0.00% 48 53 0.00% 49 71 0.00% 50 53 0.00% 51 57 0.00% 52 57 0.00% 53 88 0.00% 54 59 0.00% 55 69 0.00% 56 78 0.00% 57 68 0.00% 58 73 0.00% 59 83 0.00% 60 96 0.00% 61 87 0.00% 62 110 0.00% 63 79 0.00% 64 71 0.00% 65 93 0.00% 66 115 0.00% 67 85 0.00% 68 118 0.00% 69 100 0.00% 70 92 0.00% 71 109 0.00% 72 115 0.00% 73 116 0.00% 74 125 0.00% 75 139 0.00% 76 122 0.00% 77 127 0.00% 78 114 0.00% 79 137 0.00% 80 115 0.00% 81 162 0.00% 82 154 0.00% 83 186 0.00% 84 185 0.00% 85 203 0.00% 86 205 0.00% 87 198 0.00% 88 208 0.00% 89 262 0.00% 90 306 0.00% 91 866 0.01% 92 336 0.00% 93 456 0.00% 94 876 0.01% 95 3381 0.02% 96 19120 0.14% 97 66665 0.47% 98 258302 1.83% 99 952864 6.74% 100 3240620 22.94% 101 9577717 67.80% 14126998 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=21 prefix-density=0.19 prefix-fanout=2.2 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=212.86 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=23.1 sequence=CCGCCGCCGCCA Started job on | Dec 06 15:23:37 Started mapping on | Dec 06 15:23:37 Finished on | Dec 06 15:23:55 Mapping speed, Million of reads per hour | 2825.40 Number of input reads | 14126998 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13003083 Uniquely mapped reads % | 92.04% Average mapped length | 100.25 Number of splices: Total | 4602064 Number of splices: Annotated (sjdb) | 4352951 Number of splices: GT/AG | 4533687 Number of splices: GC/AG | 60392 Number of splices: AT/AC | 2672 Number of splices: Non-canonical | 5313 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.79 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486517 % of reads mapped to multiple loci | 3.44% Number of reads mapped to too many loci | 427484 % of reads mapped to too many loci | 3.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.06% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637398 637398 637398 N_multimapping 486517 486517 486517 N_noFeature 627225 6732020 6720216 N_ambiguous 206047 13986 15476 UnstrandedReadsAssigned:12169811 PositiveStrandReadsAssigned:6257077 NegativeStrandReadsAssigned:6267391 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853461 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853461-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,126,998 reads, 12,612,381 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR21853461.ke.tsv 35125 SRR21853461.se.tsv 88098 total ==> SRR21853461.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 65.2894 9.53876 PNS24249 1928 1829 153.032 11.5518 PNS24246 1044 945 65.2894 9.53876 PNS24248 1044 945 65.2894 9.53876 PNS24244 1471 1372 21.0994 2.12323 PNS24243 293 194 31 22.0618 KQK14069 1603 1504 11694.5 1073.53 KQK14071 474 375 2005.28 738.285 ==> SRR21853461.se.tsv <== BRADI_1g14170v3 14947 BRADI_1g53295v3 81 BRADI_1g59795v3 301 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 867 BRADI_1g74790v3 210 BRADI_1g09890v3 5 BRADI_1g77505v3 223 BRADI_1g48960v3 0 SRR21853461 completed mapping pipeline successfully