Starting /dee2/code/volunteer_pipeline.sh SRR21853462 current disk space = 1550436327424 free memory = 1599240600 SRR21853462 SRAfilesize 08ea01b912111dd4fc7d3c5e28346117 SRR21853462.sra SRR21853462.sra file validated SRR21853462 is single end SRR21853462 is conventional basespace SRR21853462 read1 length is 96-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 96-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.1065 32.0 32.0 32.0 32.0 32.0 2 31.4135 32.0 32.0 32.0 32.0 32.0 3 31.4415 32.0 32.0 32.0 32.0 32.0 4 31.53975 32.0 32.0 32.0 32.0 32.0 5 31.46325 32.0 32.0 32.0 32.0 32.0 6 34.845 36.0 36.0 36.0 36.0 36.0 7 35.1605 36.0 36.0 36.0 36.0 36.0 8 35.048 36.0 36.0 36.0 36.0 36.0 9 35.1275 36.0 36.0 36.0 36.0 36.0 10-11 35.12525 36.0 36.0 36.0 36.0 36.0 12-13 35.141 36.0 36.0 36.0 36.0 36.0 14-15 35.052 36.0 36.0 36.0 36.0 36.0 16-17 35.04 36.0 36.0 36.0 36.0 36.0 18-19 34.991749999999996 36.0 36.0 36.0 36.0 36.0 20-21 34.9655 36.0 36.0 36.0 34.0 36.0 22-23 35.008125 36.0 36.0 36.0 34.0 36.0 24-25 34.883250000000004 36.0 36.0 36.0 34.0 36.0 26-27 34.874375 36.0 36.0 36.0 34.0 36.0 28-29 34.927499999999995 36.0 36.0 36.0 32.0 36.0 30-31 34.838 36.0 36.0 36.0 32.0 36.0 32-33 34.762 36.0 36.0 36.0 32.0 36.0 34-35 34.794250000000005 36.0 36.0 36.0 32.0 36.0 36-37 34.79625 36.0 36.0 36.0 32.0 36.0 38-39 34.64275 36.0 36.0 36.0 32.0 36.0 40-41 34.749375 36.0 36.0 36.0 34.0 36.0 42-43 34.68425 36.0 36.0 36.0 32.0 36.0 44-45 34.60575 36.0 36.0 36.0 32.0 36.0 46-47 34.755875 36.0 36.0 36.0 32.0 36.0 48-49 34.679375 36.0 36.0 36.0 32.0 36.0 50-51 34.683 36.0 36.0 36.0 32.0 36.0 52-53 34.5695 36.0 36.0 36.0 32.0 36.0 54-55 34.429 36.0 36.0 36.0 32.0 36.0 56-57 34.41275 36.0 36.0 36.0 32.0 36.0 58-59 34.32375 36.0 36.0 36.0 32.0 36.0 60-61 34.41575 36.0 36.0 36.0 32.0 36.0 62-63 34.287 36.0 36.0 36.0 32.0 36.0 64-65 34.194874999999996 36.0 36.0 36.0 32.0 36.0 66-67 34.249375 36.0 36.0 36.0 32.0 36.0 68-69 34.3745 36.0 36.0 36.0 32.0 36.0 70-71 34.149874999999994 36.0 36.0 36.0 32.0 36.0 72-73 34.155625 36.0 36.0 36.0 32.0 36.0 74-75 34.01275 36.0 36.0 36.0 32.0 36.0 76-77 34.049125000000004 36.0 36.0 36.0 32.0 36.0 78-79 33.956 36.0 36.0 36.0 32.0 36.0 80-81 33.9365 36.0 36.0 36.0 32.0 36.0 82-83 33.88075 36.0 36.0 36.0 29.5 36.0 84-85 33.95025 36.0 36.0 36.0 29.5 36.0 86-87 33.903 36.0 36.0 36.0 32.0 36.0 88-89 33.871875 36.0 36.0 36.0 29.5 36.0 90-91 33.826375 36.0 36.0 36.0 27.0 36.0 92-93 33.893625 36.0 36.0 36.0 29.5 36.0 94-95 33.89725 36.0 36.0 36.0 29.5 36.0 96-97 33.80399981207717 36.0 36.0 36.0 29.5 36.0 98-99 33.79708845622348 36.0 36.0 36.0 27.0 36.0 100-101 32.876205981632324 36.0 34.0 36.0 24.0 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 4.0 23 7.0 24 5.0 25 21.0 26 22.0 27 49.0 28 59.0 29 75.0 30 108.0 31 143.0 32 184.0 33 336.0 34 698.0 35 2285.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.325000000000003 14.825 18.675 37.175000000000004 2 25.2 19.875 31.075000000000003 23.849999999999998 3 24.55 25.75 23.75 25.95 4 25.2 30.625000000000004 19.775000000000002 24.4 5 26.85 31.7 20.474999999999998 20.974999999999998 6 22.121896162528216 33.28317030348633 20.89290193127665 23.702031602708804 7 20.225 16.05 41.349999999999994 22.375 8 24.075 21.0 24.275 30.65 9 21.8 20.9 28.525 28.775000000000002 10-11 26.0125 28.487499999999997 20.2125 25.2875 12-13 22.5 22.9625 27.437499999999996 27.1 14-15 23.875 24.575 25.275 26.275 16-17 24.875 24.65 24.4125 26.0625 18-19 23.8375 24.85 24.95 26.3625 20-21 25.4 25.0 23.45 26.150000000000002 22-23 24.2875 25.4 25.112499999999997 25.2 24-25 24.3625 25.637500000000003 24.075 25.924999999999997 26-27 24.337500000000002 25.0 25.2125 25.45 28-29 25.4 24.425 24.212500000000002 25.9625 30-31 23.525 25.55 25.162499999999998 25.7625 32-33 25.2125 24.3625 24.7375 25.687500000000004 34-35 25.0375 25.525 24.525 24.9125 36-37 24.349999999999998 24.75 25.624999999999996 25.275 38-39 25.112499999999997 25.3 24.125 25.4625 40-41 24.625 24.925 24.5625 25.887500000000003 42-43 24.224999999999998 25.074999999999996 24.8125 25.887500000000003 44-45 24.975 26.0 23.6375 25.387500000000003 46-47 24.762500000000003 25.362499999999997 24.025 25.85 48-49 25.087500000000002 24.7375 24.175 26.0 50-51 24.6125 25.8 24.1125 25.474999999999998 52-53 24.55 25.575 24.2 25.674999999999997 54-55 25.75 24.675 24.8 24.775 56-57 25.7375 24.8 24.587500000000002 24.875 58-59 24.525 24.925 24.9875 25.5625 60-61 25.087500000000002 24.7875 24.099999999999998 26.025 62-63 24.95 24.85 24.45 25.75 64-65 26.275 24.462500000000002 23.5875 25.674999999999997 66-67 24.95 24.099999999999998 25.25 25.7 68-69 24.9875 24.675 24.962500000000002 25.374999999999996 70-71 25.5625 24.887500000000003 23.2875 26.2625 72-73 24.7375 24.8625 24.9 25.5 74-75 25.2125 25.124999999999996 23.9 25.7625 76-77 24.45 24.65 24.224999999999998 26.674999999999997 78-79 25.55 24.7 24.3875 25.362499999999997 80-81 25.15 24.875 24.725 25.25 82-83 25.412499999999998 24.5125 24.0625 26.0125 84-85 24.712500000000002 25.137500000000003 24.45 25.7 86-87 25.05 25.324999999999996 24.212500000000002 25.412499999999998 88-89 25.637500000000003 25.3125 24.0375 25.0125 90-91 25.224999999999998 25.4 24.4 24.975 92-93 25.162499999999998 24.65 24.762500000000003 25.424999999999997 94-95 26.200000000000003 23.7375 24.3625 25.7 96-97 24.30234013264923 24.377424602678012 25.616318358152924 25.703916906519837 98-99 24.84432583555725 24.297877748125558 24.48849917397382 26.36929724234337 100-101 25.785071800536528 11.519646520435538 30.329809057913838 32.365472621114094 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 4.5 30 9.5 31 13.5 32 19.5 33 20.0 34 21.0 35 30.5 36 39.5 37 49.0 38 65.0 39 87.5 40 122.0 41 146.0 42 156.5 43 175.0 44 178.0 45 184.5 46 186.5 47 174.5 48 176.5 49 168.0 50 161.5 51 162.0 52 138.5 53 122.0 54 114.5 55 97.5 56 94.5 57 86.0 58 76.5 59 69.0 60 67.5 61 72.0 62 63.0 63 66.0 64 58.5 65 48.5 66 59.0 67 60.0 68 44.0 69 36.5 70 45.0 71 44.0 72 41.0 73 33.5 74 26.0 75 21.5 76 13.5 77 12.5 78 9.5 79 6.5 80 5.0 81 2.0 82 2.0 83 2.0 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.325 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 96 9.0 97 17.0 98 79.0 99 285.0 100 883.0 101 2727.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489907 spots for SRR21853462.sra Written 489907 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra Read 489904 spots for SRR21853462.sra Written 489904 spots for SRR21853462.sra SRR ids: ['SRR21853462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jntjaofq SRR21853462.sra spots: 9798083 blocks: [[1, 489904], [489905, 979808], [979809, 1469712], [1469713, 1959616], [1959617, 2449520], [2449521, 2939424], [2939425, 3429328], [3429329, 3919232], [3919233, 4409136], [4409137, 4899040], [4899041, 5388944], [5388945, 5878848], [5878849, 6368752], [6368753, 6858656], [6858657, 7348560], [7348561, 7838464], [7838465, 8328368], [8328369, 8818272], [8818273, 9308176], [9308177, 9798083]] SRR21853462 file size 2670385 SRR21853462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853462 SRR21853462_1.fastq Input file: SRR21853462_1.fastq trimmed: SRR21853462-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:23:31 2024 >> started Fri Dec 6 15:23:37 2024 >> done (5.323s) 9798083 reads processed; of these: 11 ( 0.00%) short reads filtered out after trimming by size control 24693 ( 0.25%) empty reads filtered out after trimming by size control 9773379 (99.75%) reads available; of these: 61 ( 0.00%) trimmed reads available after processing 9773318 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 16 0.00% 36 24 0.00% 37 34 0.00% 38 21 0.00% 39 31 0.00% 40 19 0.00% 41 24 0.00% 42 23 0.00% 43 27 0.00% 44 27 0.00% 45 32 0.00% 46 26 0.00% 47 25 0.00% 48 38 0.00% 49 47 0.00% 50 34 0.00% 51 31 0.00% 52 27 0.00% 53 29 0.00% 54 30 0.00% 55 35 0.00% 56 34 0.00% 57 45 0.00% 58 34 0.00% 59 42 0.00% 60 46 0.00% 61 44 0.00% 62 49 0.00% 63 41 0.00% 64 41 0.00% 65 48 0.00% 66 51 0.00% 67 37 0.00% 68 43 0.00% 69 47 0.00% 70 49 0.00% 71 57 0.00% 72 58 0.00% 73 56 0.00% 74 79 0.00% 75 63 0.00% 76 63 0.00% 77 64 0.00% 78 84 0.00% 79 77 0.00% 80 84 0.00% 81 96 0.00% 82 86 0.00% 83 94 0.00% 84 101 0.00% 85 103 0.00% 86 135 0.00% 87 119 0.00% 88 135 0.00% 89 184 0.00% 90 191 0.00% 91 524 0.01% 92 232 0.00% 93 280 0.00% 94 589 0.01% 95 2312 0.02% 96 12350 0.13% 97 46499 0.48% 98 178390 1.83% 99 642051 6.57% 100 2270745 23.23% 101 6616223 67.70% 9773379 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=20 prefix-density=0.19 prefix-fanout=2.2 sequence=CCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=14 fanout-score=195.46 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=23.5 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:23:53 Started mapping on | Dec 06 15:23:53 Finished on | Dec 06 15:24:09 Mapping speed, Million of reads per hour | 2199.01 Number of input reads | 9773379 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8977605 Uniquely mapped reads % | 91.86% Average mapped length | 100.25 Number of splices: Total | 3181519 Number of splices: Annotated (sjdb) | 3010434 Number of splices: GT/AG | 3134817 Number of splices: GC/AG | 41624 Number of splices: AT/AC | 1879 Number of splices: Non-canonical | 3199 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 331193 % of reads mapped to multiple loci | 3.39% Number of reads mapped to too many loci | 309455 % of reads mapped to too many loci | 3.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 464581 464581 464581 N_multimapping 331193 331193 331193 N_noFeature 457414 4662218 4650621 N_ambiguous 142088 9731 11124 UnstrandedReadsAssigned:8378103 PositiveStrandReadsAssigned:4305656 NegativeStrandReadsAssigned:4315860 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853462 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853462-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,773,379 reads, 8,719,245 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52973 SRR21853462.ke.tsv 35125 SRR21853462.se.tsv 88098 total ==> SRR21853462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 36.3236 7.75007 PNS24249 1928 1829 108.72 11.9851 PNS24246 1044 945 36.3236 7.75007 PNS24248 1044 945 36.3236 7.75007 PNS24244 1471 1372 30.3097 4.45426 PNS24243 293 194 19 19.747 KQK14069 1603 1504 6901.82 925.261 KQK14071 474 375 1116.09 600.092 ==> SRR21853462.se.tsv <== BRADI_1g14170v3 8936 BRADI_1g53295v3 86 BRADI_1g59795v3 173 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 639 BRADI_1g74790v3 139 BRADI_1g09890v3 2 BRADI_1g77505v3 151 BRADI_1g48960v3 0 SRR21853462 completed mapping pipeline successfully