Starting /dee2/code/volunteer_pipeline.sh SRR21853463 current disk space = 1550384218112 free memory = 1599076972 SRR21853463 SRAfilesize a5cf3c194b43e522ae152333dfbfb362 SRR21853463.sra SRR21853463.sra file validated SRR21853463 is single end SRR21853463 is conventional basespace SRR21853463 read1 length is 40-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 40-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.5195 37.0 37.0 37.0 37.0 37.0 2 35.6285 37.0 37.0 37.0 37.0 37.0 3 35.923 37.0 37.0 37.0 37.0 37.0 4 36.008 37.0 37.0 37.0 37.0 37.0 5 35.93 37.0 37.0 37.0 37.0 37.0 6 35.9805 37.0 37.0 37.0 37.0 37.0 7 35.9615 37.0 37.0 37.0 37.0 37.0 8 36.0955 37.0 37.0 37.0 37.0 37.0 9 35.8945 37.0 37.0 37.0 37.0 37.0 10-11 36.01175 37.0 37.0 37.0 37.0 37.0 12-13 36.055499999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.876 37.0 37.0 37.0 37.0 37.0 16-17 35.8995 37.0 37.0 37.0 37.0 37.0 18-19 35.85075 37.0 37.0 37.0 37.0 37.0 20-21 35.80925 37.0 37.0 37.0 37.0 37.0 22-23 35.8445 37.0 37.0 37.0 37.0 37.0 24-25 35.903999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.798500000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.722750000000005 37.0 37.0 37.0 37.0 37.0 30-31 35.73125 37.0 37.0 37.0 37.0 37.0 32-33 35.701 37.0 37.0 37.0 37.0 37.0 34-35 35.7125 37.0 37.0 37.0 37.0 37.0 36-37 35.6665 37.0 37.0 37.0 37.0 37.0 38-39 35.80225 37.0 37.0 37.0 37.0 37.0 40-41 35.827855026256564 37.0 37.0 37.0 37.0 37.0 42-43 35.72718179544886 37.0 37.0 37.0 37.0 37.0 44-45 35.60065016254063 37.0 37.0 37.0 37.0 37.0 46-47 35.73018254563641 37.0 37.0 37.0 37.0 37.0 48-49 35.6781695423856 37.0 37.0 37.0 37.0 37.0 50-51 35.71592898224556 37.0 37.0 37.0 37.0 37.0 52-53 35.72093023255814 37.0 37.0 37.0 37.0 37.0 54-55 35.595398849712424 37.0 37.0 37.0 37.0 37.0 56-57 35.70317579394849 37.0 37.0 37.0 37.0 37.0 58-59 35.62690672668167 37.0 37.0 37.0 37.0 37.0 60-61 35.65391347836959 37.0 37.0 37.0 37.0 37.0 62-63 35.68317079269818 37.0 37.0 37.0 37.0 37.0 64-65 35.522130532633156 37.0 37.0 37.0 37.0 37.0 66-67 35.60390097524381 37.0 37.0 37.0 37.0 37.0 68-69 35.57239309827457 37.0 37.0 37.0 37.0 37.0 70-71 35.71502611771002 37.0 37.0 37.0 37.0 37.0 72-73 35.540520260130066 37.0 37.0 37.0 37.0 37.0 74-75 35.55552776388194 37.0 37.0 37.0 37.0 37.0 76-77 35.6255627813907 37.0 37.0 37.0 37.0 37.0 78-79 35.56334960074483 37.0 37.0 37.0 37.0 37.0 80-81 35.541155866900176 37.0 37.0 37.0 37.0 37.0 82-83 35.522141606204656 37.0 37.0 37.0 37.0 37.0 84-85 35.59119339504628 37.0 37.0 37.0 37.0 37.0 86-87 35.51788841631223 37.0 37.0 37.0 37.0 37.0 88-89 35.518889166875155 37.0 37.0 37.0 37.0 37.0 90-91 35.4954954954955 37.0 37.0 37.0 37.0 37.0 92-93 35.4054054054054 37.0 37.0 37.0 37.0 37.0 94-95 35.487487487487485 37.0 37.0 37.0 37.0 37.0 96-97 35.503455310877584 37.0 37.0 37.0 37.0 37.0 98-99 35.40327538878072 37.0 37.0 37.0 37.0 37.0 100-101 35.234252941571214 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 1.0 25 7.0 26 6.0 27 22.0 28 25.0 29 46.0 30 58.0 31 103.0 32 122.0 33 155.0 34 231.0 35 524.0 36 2214.0 37 482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.924999999999997 15.4 18.224999999999998 40.45 2 25.275 19.15 28.075 27.500000000000004 3 26.8 21.125 23.724999999999998 28.349999999999998 4 26.375 26.650000000000002 19.15 27.825 5 28.025 28.799999999999997 21.875 21.3 6 23.25 32.7 21.55 22.5 7 19.925 18.6 39.5 21.975 8 22.375 23.425 27.55 26.650000000000002 9 21.775 21.224999999999998 29.225 27.775 10-11 22.8625 29.925 22.45 24.762500000000003 12-13 23.7875 23.5 27.1375 25.575 14-15 23.125 25.45 26.3 25.124999999999996 16-17 23.75 26.0625 25.337500000000002 24.85 18-19 23.4375 26.325 25.2375 25.0 20-21 24.15 26.5875 24.4125 24.85 22-23 23.525 27.125 24.75 24.6 24-25 24.2 25.8625 25.85 24.087500000000002 26-27 24.1375 25.924999999999997 25.75 24.1875 28-29 23.200000000000003 25.424999999999997 25.324999999999996 26.05 30-31 23.175 25.7875 25.4375 25.6 32-33 23.6875 26.150000000000002 24.4 25.7625 34-35 22.75 26.9125 24.75 25.587500000000002 36-37 24.175 25.75 25.074999999999996 25.0 38-39 23.4375 26.937499999999996 24.6875 24.9375 40-41 23.8404800600075 26.740842605325664 25.053131641455185 24.36554569321165 42-43 24.418604651162788 24.81870467616904 25.543885971492873 25.218804701175294 44-45 24.831207801950487 26.04401100275069 25.393848462115532 23.730932733183295 46-47 24.06851712928232 26.481620405101275 25.006251562890725 24.44361090272568 48-49 22.393098274568644 25.93148287071768 25.76894223555889 25.906476619154787 50-51 23.718429607401852 26.03150787696924 25.11877969492373 25.131282820705174 52-53 23.768442110527634 26.081520380095025 24.706176544136035 25.44386096524131 54-55 23.893473368342086 26.356589147286826 25.03125781445361 24.718679669917478 56-57 24.69367341835459 25.28132033008252 25.331332833208304 24.69367341835459 58-59 23.55588897224306 25.268817204301076 25.393848462115532 25.78144536134033 60-61 24.143535883970994 25.268817204301076 25.55638909727432 25.03125781445361 62-63 23.34333583395849 26.581645411352838 25.068767191797946 25.006251562890725 64-65 25.018754688672168 26.344086021505376 24.281070267566893 24.356089022255563 66-67 24.243560890222557 26.51912978244561 25.10627656914228 24.131032758189548 68-69 24.643660915228807 25.331332833208304 25.206301575393848 24.81870467616904 70-71 24.721770663999 25.959734900587723 24.609228460672753 24.70926597474053 72-73 23.861930965482742 26.463231615807903 25.237618809404704 24.437218609304654 74-75 24.037018509254626 25.76288144072036 25.0 25.200100050025014 76-77 23.974487243621812 26.000500250125064 24.749874937468736 25.275137568784395 78-79 23.61475922451532 25.92870544090056 24.702939337085677 25.753595997498437 80-81 23.46760070052539 26.394796097072803 25.168876657493122 24.96872654490868 82-83 24.505879409557167 24.943707780835627 26.419814861145856 24.130597948461347 84-85 23.505128846634975 25.21891418563923 25.21891418563923 26.057042782086565 86-87 23.01726294721041 25.819364523392547 25.369026770077557 25.794345759319487 88-89 24.44333249937453 26.482361771328495 24.618463847885916 24.455841881411057 90-91 24.374374374374376 25.43793793793794 25.813313313313312 24.374374374374376 92-93 24.34934934934935 25.012512512512515 25.95095095095095 24.687187187187188 94-95 23.686186186186188 25.863363363363362 25.275275275275277 25.175175175175173 96-97 23.847695390781563 24.649298597194388 25.93937875751503 25.56362725450902 98-99 23.990802248339293 24.054675523760856 26.303014818599895 25.65150740929995 100-101 25.336107554417413 11.60371318822023 31.850192061459666 31.209987195902688 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 4.0 27 4.0 28 7.0 29 8.5 30 9.5 31 14.5 32 21.0 33 26.5 34 33.0 35 37.0 36 41.0 37 61.0 38 89.0 39 114.0 40 134.0 41 166.0 42 179.5 43 175.5 44 189.0 45 197.0 46 191.5 47 197.5 48 184.0 49 166.0 50 169.5 51 153.0 52 139.5 53 127.0 54 112.5 55 100.5 56 88.0 57 78.0 58 67.0 59 68.5 60 63.5 61 53.0 62 52.5 63 52.0 64 53.0 65 43.0 66 38.5 67 41.0 68 37.0 69 38.5 70 32.0 71 28.0 72 26.0 73 20.5 74 20.0 75 16.5 76 11.0 77 7.5 78 6.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 1.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 1.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 40.0 98-99 345.0 100-101 3611.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7366737739872 87.925 2 5.91684434968017 11.1 3 0.3464818763326226 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra Read 505699 spots for SRR21853463.sra Written 505699 spots for SRR21853463.sra Read 505697 spots for SRR21853463.sra Written 505697 spots for SRR21853463.sra SRR ids: ['SRR21853463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gji89md4 SRR21853463.sra spots: 10113942 blocks: [[1, 505697], [505698, 1011394], [1011395, 1517091], [1517092, 2022788], [2022789, 2528485], [2528486, 3034182], [3034183, 3539879], [3539880, 4045576], [4045577, 4551273], [4551274, 5056970], [5056971, 5562667], [5562668, 6068364], [6068365, 6574061], [6574062, 7079758], [7079759, 7585455], [7585456, 8091152], [8091153, 8596849], [8596850, 9102546], [9102547, 9608243], [9608244, 10113942]] SRR21853463 file size 2719428 SRR21853463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853463 SRR21853463_1.fastq Input file: SRR21853463_1.fastq trimmed: SRR21853463-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:26:55 2024 >> started Fri Dec 6 15:27:00 2024 >> done (5.237s) 10113942 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 1538 ( 0.02%) empty reads filtered out after trimming by size control 10112402 (99.98%) reads available; of these: 321 ( 0.00%) trimmed reads available after processing 10112081 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 5 0.00% 32 2 0.00% 33 9 0.00% 34 2 0.00% 35 12 0.00% 36 19 0.00% 37 19 0.00% 38 18 0.00% 39 24 0.00% 40 22 0.00% 41 20 0.00% 42 17 0.00% 43 23 0.00% 44 19 0.00% 45 23 0.00% 46 26 0.00% 47 17 0.00% 48 20 0.00% 49 35 0.00% 50 23 0.00% 51 22 0.00% 52 17 0.00% 53 24 0.00% 54 22 0.00% 55 19 0.00% 56 33 0.00% 57 31 0.00% 58 29 0.00% 59 39 0.00% 60 39 0.00% 61 33 0.00% 62 50 0.00% 63 42 0.00% 64 39 0.00% 65 47 0.00% 66 36 0.00% 67 36 0.00% 68 43 0.00% 69 51 0.00% 70 61 0.00% 71 52 0.00% 72 44 0.00% 73 40 0.00% 74 60 0.00% 75 60 0.00% 76 55 0.00% 77 69 0.00% 78 74 0.00% 79 77 0.00% 80 70 0.00% 81 71 0.00% 82 67 0.00% 83 81 0.00% 84 91 0.00% 85 99 0.00% 86 85 0.00% 87 89 0.00% 88 114 0.00% 89 137 0.00% 90 180 0.00% 91 473 0.00% 92 180 0.00% 93 233 0.00% 94 504 0.00% 95 2052 0.02% 96 13497 0.13% 97 50426 0.50% 98 191301 1.89% 99 678588 6.71% 100 2420322 23.93% 101 6752137 66.77% 10112402 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=15 prefix-density=0.20 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=136.23 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=19.7 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:27:18 Started mapping on | Dec 06 15:27:18 Finished on | Dec 06 15:27:37 Mapping speed, Million of reads per hour | 1916.03 Number of input reads | 10112402 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 8906536 Uniquely mapped reads % | 88.08% Average mapped length | 100.29 Number of splices: Total | 3310716 Number of splices: Annotated (sjdb) | 3133230 Number of splices: GT/AG | 3262334 Number of splices: GC/AG | 44152 Number of splices: AT/AC | 1981 Number of splices: Non-canonical | 2249 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422900 % of reads mapped to multiple loci | 4.18% Number of reads mapped to too many loci | 365669 % of reads mapped to too many loci | 3.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 782966 782966 782966 N_multimapping 422900 422900 422900 N_noFeature 521085 4784631 4519788 N_ambiguous 143322 9467 11523 UnstrandedReadsAssigned:8242129 PositiveStrandReadsAssigned:4112438 NegativeStrandReadsAssigned:4375225 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853463 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853463-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,112,402 reads, 8,569,771 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52973 SRR21853463.ke.tsv 35125 SRR21853463.se.tsv 88098 total ==> SRR21853463.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 43.8143 10.0235 PNS24249 1928 1829 66.2019 7.82512 PNS24246 1044 945 43.8143 10.0235 PNS24248 1044 945 43.8143 10.0235 PNS24244 1471 1372 29.3551 4.62556 PNS24243 293 194 20 22.2875 KQK14069 1603 1504 6080.78 874.068 KQK14071 474 375 642.589 370.456 ==> SRR21853463.se.tsv <== BRADI_1g14170v3 7716 BRADI_1g53295v3 88 BRADI_1g59795v3 256 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 639 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 151 BRADI_1g48960v3 0 SRR21853463 completed mapping pipeline successfully