Starting /dee2/code/volunteer_pipeline.sh SRR21853464 current disk space = 1550371524608 free memory = 1599898832 SRR21853464 SRAfilesize 09f27f668e9a9ff4f883b6217f92b948 SRR21853464.sra SRR21853464.sra file validated SRR21853464 is single end SRR21853464 is conventional basespace SRR21853464 read1 length is 60-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 60-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0525 37.0 37.0 37.0 25.0 37.0 2 34.71625 37.0 37.0 37.0 25.0 37.0 3 35.466 37.0 37.0 37.0 37.0 37.0 4 35.608 37.0 37.0 37.0 37.0 37.0 5 35.7385 37.0 37.0 37.0 37.0 37.0 6 35.75 37.0 37.0 37.0 37.0 37.0 7 35.516 37.0 37.0 37.0 37.0 37.0 8 35.798 37.0 37.0 37.0 37.0 37.0 9 35.7905 37.0 37.0 37.0 37.0 37.0 10-11 35.856750000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.838750000000005 37.0 37.0 37.0 37.0 37.0 14-15 35.853750000000005 37.0 37.0 37.0 37.0 37.0 16-17 35.715 37.0 37.0 37.0 37.0 37.0 18-19 35.69775 37.0 37.0 37.0 37.0 37.0 20-21 35.777249999999995 37.0 37.0 37.0 37.0 37.0 22-23 35.75825 37.0 37.0 37.0 37.0 37.0 24-25 35.71125 37.0 37.0 37.0 37.0 37.0 26-27 35.596000000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.5235 37.0 37.0 37.0 37.0 37.0 30-31 35.549 37.0 37.0 37.0 37.0 37.0 32-33 35.56275 37.0 37.0 37.0 37.0 37.0 34-35 35.5585 37.0 37.0 37.0 37.0 37.0 36-37 35.51625 37.0 37.0 37.0 37.0 37.0 38-39 35.58425 37.0 37.0 37.0 37.0 37.0 40-41 35.483999999999995 37.0 37.0 37.0 37.0 37.0 42-43 35.4815 37.0 37.0 37.0 37.0 37.0 44-45 35.44625 37.0 37.0 37.0 37.0 37.0 46-47 35.54275 37.0 37.0 37.0 37.0 37.0 48-49 35.56375 37.0 37.0 37.0 37.0 37.0 50-51 35.4715 37.0 37.0 37.0 37.0 37.0 52-53 35.535250000000005 37.0 37.0 37.0 37.0 37.0 54-55 35.40375 37.0 37.0 37.0 37.0 37.0 56-57 35.5835 37.0 37.0 37.0 37.0 37.0 58-59 35.3885 37.0 37.0 37.0 37.0 37.0 60-61 35.44880151287822 37.0 37.0 37.0 37.0 37.0 62-63 35.39034758689672 37.0 37.0 37.0 37.0 37.0 64-65 35.42585646411602 37.0 37.0 37.0 37.0 37.0 66-67 35.4143535883971 37.0 37.0 37.0 37.0 37.0 68-69 35.31711898710045 37.0 37.0 37.0 37.0 37.0 70-71 35.34792396198099 37.0 37.0 37.0 37.0 37.0 72-73 35.32166083041521 37.0 37.0 37.0 37.0 37.0 74-75 35.31815907953977 37.0 37.0 37.0 37.0 37.0 76-77 35.235367683841915 37.0 37.0 37.0 31.0 37.0 78-79 35.21985992996498 37.0 37.0 37.0 25.0 37.0 80-81 35.1328164082041 37.0 37.0 37.0 25.0 37.0 82-83 35.32491245622812 37.0 37.0 37.0 37.0 37.0 84-85 35.22086043021511 37.0 37.0 37.0 31.0 37.0 86-87 35.346173086543274 37.0 37.0 37.0 37.0 37.0 88-89 35.233218019119946 37.0 37.0 37.0 31.0 37.0 90-91 35.14814814814815 37.0 37.0 37.0 25.0 37.0 92-93 35.24405506883605 37.0 37.0 37.0 31.0 37.0 94-95 35.26232790988736 37.0 37.0 37.0 31.0 37.0 96-97 35.219138666682774 37.0 37.0 37.0 31.0 37.0 98-99 35.141276810497104 37.0 37.0 37.0 25.0 37.0 100-101 35.037346553957846 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 7.0 24 4.0 25 4.0 26 11.0 27 28.0 28 41.0 29 67.0 30 86.0 31 93.0 32 135.0 33 197.0 34 284.0 35 519.0 36 2111.0 37 410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.525000000000002 13.075000000000001 17.349999999999998 40.050000000000004 2 25.145459144953204 20.946116873260813 30.02782696686061 23.88059701492537 3 26.400000000000002 24.925 23.200000000000003 25.474999999999998 4 26.474999999999998 29.45 18.725 25.35 5 26.450000000000003 30.725 20.9 21.925 6 22.375 33.75 20.974999999999998 22.900000000000002 7 20.0 17.4 39.4 23.200000000000003 8 21.925 21.8 26.174999999999997 30.099999999999998 9 21.45 21.4 28.475 28.675 10-11 25.424999999999997 28.4125 21.4375 24.725 12-13 23.3875 22.7 26.400000000000002 27.5125 14-15 23.925 24.9125 25.825 25.337500000000002 16-17 24.837500000000002 24.525 24.9375 25.7 18-19 24.4375 25.1 25.4375 25.025 20-21 24.962500000000002 25.8625 24.9 24.275 22-23 24.375 25.662499999999998 24.45 25.5125 24-25 23.25 25.687500000000004 25.724999999999998 25.337500000000002 26-27 23.3875 25.887500000000003 25.224999999999998 25.5 28-29 24.825 25.887500000000003 24.4125 24.875 30-31 24.7875 26.4125 24.4 24.4 32-33 25.1 25.874999999999996 23.849999999999998 25.174999999999997 34-35 24.2875 26.075 24.099999999999998 25.5375 36-37 25.025 24.962500000000002 24.375 25.637500000000003 38-39 24.55 25.900000000000002 24.175 25.374999999999996 40-41 25.15 25.0 23.8375 26.0125 42-43 24.2375 24.9875 25.7125 25.0625 44-45 24.8625 25.887500000000003 24.5125 24.7375 46-47 24.7875 24.8625 24.8 25.55 48-49 24.4125 24.775 24.7875 26.025 50-51 24.7375 25.35 24.825 25.087500000000002 52-53 25.162499999999998 24.3125 24.6625 25.8625 54-55 24.887500000000003 23.9375 24.762500000000003 26.4125 56-57 24.5125 25.1 24.825 25.5625 58-59 23.8125 25.387500000000003 25.05 25.75 60-61 24.065508188523566 25.803225403175396 24.715589448681087 25.415676959619955 62-63 25.743935983995996 24.843710927731934 24.356089022255563 25.056264066016503 64-65 24.656164041010253 25.84396099024756 24.781195298824706 24.718679669917478 66-67 24.468617154288573 24.968742185546386 24.8062015503876 25.756439109777446 68-69 24.546705014380393 24.99687382768538 24.371639364761783 26.08478179317244 70-71 24.424712356178087 25.950475237618807 23.874437218609305 25.7503751875938 72-73 24.399699849924964 25.100050025012504 24.81240620310155 25.68784392196098 74-75 24.112056028014006 25.850425212606304 24.499749874937468 25.53776888444222 76-77 24.437218609304654 25.200100050025014 25.15007503751876 25.212606303151574 78-79 24.312156078039017 24.77488744372186 25.63781890945473 25.275137568784395 80-81 24.212106053026513 25.48774387193597 24.61230615307654 25.68784392196098 82-83 24.224612306153077 26.350675337668832 24.12456228114057 25.30015007503752 84-85 25.025012506253123 24.862431215607803 24.92496248124062 25.18759379689845 86-87 24.487243621810904 25.275137568784395 24.599799899949975 25.63781890945473 88-89 25.284624046040282 24.846740898286 25.309645940197672 24.55898911547604 90-91 24.94994994994995 24.974974974974977 25.037537537537535 25.037537537537535 92-93 24.81852315394243 25.844806007509387 24.380475594493117 24.956195244055067 94-95 26.12015018773467 24.39299123904881 25.444305381727162 24.04255319148936 96-97 25.084660729963627 24.871441113758934 24.708390819014173 25.335507337263262 98-99 24.926872694900165 23.52791555385985 25.94429607020221 25.600915681037772 100-101 26.01420678768745 12.0284135753749 30.386740331491712 31.570639305445937 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 4.0 30 5.5 31 7.5 32 14.5 33 22.5 34 26.0 35 34.0 36 47.0 37 58.5 38 68.5 39 89.5 40 112.5 41 144.0 42 173.0 43 173.5 44 181.5 45 183.0 46 183.5 47 188.5 48 179.5 49 175.0 50 177.0 51 171.0 52 136.0 53 119.5 54 117.5 55 96.5 56 86.5 57 89.5 58 81.0 59 76.0 60 79.0 61 71.5 62 66.0 63 59.5 64 56.0 65 48.0 66 43.0 67 47.0 68 44.0 69 42.5 70 38.0 71 33.0 72 34.0 73 28.0 74 20.0 75 22.0 76 19.5 77 10.5 78 5.0 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 60 1.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 1.0 92 0.0 93 0.0 94 0.0 95 3.0 96 11.0 97 18.0 98 63.0 99 274.0 100 917.0 101 2709.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.89007470651013 87.97500000000001 2 5.549626467449306 10.4 3 0.5069370330843116 1.425 4 0.05336179295624333 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737908 spots for SRR21853464.sra Written 737908 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra Read 737903 spots for SRR21853464.sra Written 737903 spots for SRR21853464.sra SRR ids: ['SRR21853464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o694u7ii SRR21853464.sra spots: 14758065 blocks: [[1, 737903], [737904, 1475806], [1475807, 2213709], [2213710, 2951612], [2951613, 3689515], [3689516, 4427418], [4427419, 5165321], [5165322, 5903224], [5903225, 6641127], [6641128, 7379030], [7379031, 8116933], [8116934, 8854836], [8854837, 9592739], [9592740, 10330642], [10330643, 11068545], [11068546, 11806448], [11806449, 12544351], [12544352, 13282254], [13282255, 14020157], [14020158, 14758065]] SRR21853464 file size 3973043 SRR21853464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853464 SRR21853464_1.fastq Input file: SRR21853464_1.fastq trimmed: SRR21853464-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:27:49 2024 >> started Fri Dec 6 15:27:57 2024 >> done (7.675s) 14758065 reads processed; of these: 3 ( 0.00%) short reads filtered out after trimming by size control 11454 ( 0.08%) empty reads filtered out after trimming by size control 14746608 (99.92%) reads available; of these: 168 ( 0.00%) trimmed reads available after processing 14746440 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 3 0.00% 26 5 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 1 0.00% 31 5 0.00% 32 0 0.00% 33 2 0.00% 34 2 0.00% 35 19 0.00% 36 15 0.00% 37 19 0.00% 38 24 0.00% 39 22 0.00% 40 26 0.00% 41 26 0.00% 42 43 0.00% 43 24 0.00% 44 35 0.00% 45 38 0.00% 46 28 0.00% 47 52 0.00% 48 40 0.00% 49 31 0.00% 50 42 0.00% 51 53 0.00% 52 54 0.00% 53 34 0.00% 54 62 0.00% 55 37 0.00% 56 47 0.00% 57 55 0.00% 58 64 0.00% 59 83 0.00% 60 55 0.00% 61 92 0.00% 62 91 0.00% 63 89 0.00% 64 84 0.00% 65 119 0.00% 66 81 0.00% 67 124 0.00% 68 123 0.00% 69 115 0.00% 70 169 0.00% 71 152 0.00% 72 148 0.00% 73 142 0.00% 74 170 0.00% 75 177 0.00% 76 149 0.00% 77 228 0.00% 78 245 0.00% 79 261 0.00% 80 300 0.00% 81 298 0.00% 82 313 0.00% 83 441 0.00% 84 418 0.00% 85 494 0.00% 86 512 0.00% 87 487 0.00% 88 620 0.00% 89 595 0.00% 90 749 0.01% 91 1599 0.01% 92 976 0.01% 93 1157 0.01% 94 1423 0.01% 95 3803 0.03% 96 21073 0.14% 97 72898 0.49% 98 278460 1.89% 99 997185 6.76% 100 3445359 23.36% 101 9913638 67.23% 14746608 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=18 prefix-density=0.15 prefix-fanout=2.3 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=163.38 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=21.5 sequence=GCCGCCGCCGCC Started job on | Dec 06 15:28:12 Started mapping on | Dec 06 15:28:12 Finished on | Dec 06 15:28:30 Mapping speed, Million of reads per hour | 2949.32 Number of input reads | 14746608 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 13421346 Uniquely mapped reads % | 91.01% Average mapped length | 100.25 Number of splices: Total | 4884587 Number of splices: Annotated (sjdb) | 4615291 Number of splices: GT/AG | 4812912 Number of splices: GC/AG | 64392 Number of splices: AT/AC | 2903 Number of splices: Non-canonical | 4380 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 573606 % of reads mapped to multiple loci | 3.89% Number of reads mapped to too many loci | 537019 % of reads mapped to too many loci | 3.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751656 751656 751656 N_multimapping 573606 573606 573606 N_noFeature 699132 6997746 6938315 N_ambiguous 214073 14870 16146 UnstrandedReadsAssigned:12508141 PositiveStrandReadsAssigned:6408730 NegativeStrandReadsAssigned:6466885 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853464 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853464-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,746,608 reads, 13,018,683 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52973 SRR21853464.ke.tsv 35125 SRR21853464.se.tsv 88098 total ==> SRR21853464.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 103.122 14.724 PNS24249 1928 1829 96.6344 7.12893 PNS24246 1044 945 103.122 14.724 PNS24248 1044 945 103.122 14.724 PNS24244 1471 1372 0 0 PNS24243 293 194 3 2.08654 KQK14069 1603 1504 10821.6 970.842 KQK14071 474 375 1976.66 711.225 ==> SRR21853464.se.tsv <== BRADI_1g14170v3 13902 BRADI_1g53295v3 92 BRADI_1g59795v3 234 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 1040 BRADI_1g74790v3 128 BRADI_1g09890v3 0 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR21853464 completed mapping pipeline successfully