Starting /dee2/code/volunteer_pipeline.sh SRR21853465 current disk space = 1550355587072 free memory = 1367598068 SRR21853465 SRAfilesize 502399f1c7f4b99fa46d75f8eae2a995 SRR21853465.sra SRR21853465.sra file validated SRR21853465 is single end SRR21853465 is conventional basespace SRR21853465 read1 length is 75-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 75-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.568 37.0 37.0 37.0 37.0 37.0 2 35.915 37.0 37.0 37.0 37.0 37.0 3 35.9225 37.0 37.0 37.0 37.0 37.0 4 36.014 37.0 37.0 37.0 37.0 37.0 5 36.0345 37.0 37.0 37.0 37.0 37.0 6 35.995 37.0 37.0 37.0 37.0 37.0 7 36.0345 37.0 37.0 37.0 37.0 37.0 8 36.0455 37.0 37.0 37.0 37.0 37.0 9 36.0795 37.0 37.0 37.0 37.0 37.0 10-11 36.076499999999996 37.0 37.0 37.0 37.0 37.0 12-13 36.05025 37.0 37.0 37.0 37.0 37.0 14-15 36.02925 37.0 37.0 37.0 37.0 37.0 16-17 36.059 37.0 37.0 37.0 37.0 37.0 18-19 36.042500000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.83925 37.0 37.0 37.0 37.0 37.0 22-23 35.91375 37.0 37.0 37.0 37.0 37.0 24-25 35.86175 37.0 37.0 37.0 37.0 37.0 26-27 35.835 37.0 37.0 37.0 37.0 37.0 28-29 35.8555 37.0 37.0 37.0 37.0 37.0 30-31 35.74575 37.0 37.0 37.0 37.0 37.0 32-33 35.817750000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.90075 37.0 37.0 37.0 37.0 37.0 36-37 35.79775 37.0 37.0 37.0 37.0 37.0 38-39 35.8605 37.0 37.0 37.0 37.0 37.0 40-41 35.814 37.0 37.0 37.0 37.0 37.0 42-43 35.7425 37.0 37.0 37.0 37.0 37.0 44-45 35.679500000000004 37.0 37.0 37.0 37.0 37.0 46-47 35.76575 37.0 37.0 37.0 37.0 37.0 48-49 35.675 37.0 37.0 37.0 37.0 37.0 50-51 35.68075 37.0 37.0 37.0 37.0 37.0 52-53 35.704499999999996 37.0 37.0 37.0 37.0 37.0 54-55 35.74225 37.0 37.0 37.0 37.0 37.0 56-57 35.7795 37.0 37.0 37.0 37.0 37.0 58-59 35.779250000000005 37.0 37.0 37.0 37.0 37.0 60-61 35.687250000000006 37.0 37.0 37.0 37.0 37.0 62-63 35.653 37.0 37.0 37.0 37.0 37.0 64-65 35.63475 37.0 37.0 37.0 37.0 37.0 66-67 35.644 37.0 37.0 37.0 37.0 37.0 68-69 35.6 37.0 37.0 37.0 37.0 37.0 70-71 35.73025 37.0 37.0 37.0 37.0 37.0 72-73 35.719750000000005 37.0 37.0 37.0 37.0 37.0 74-75 35.715500000000006 37.0 37.0 37.0 37.0 37.0 76-77 35.58064516129032 37.0 37.0 37.0 37.0 37.0 78-79 35.671667916979246 37.0 37.0 37.0 37.0 37.0 80-81 35.617654413603404 37.0 37.0 37.0 37.0 37.0 82-83 35.717429357339334 37.0 37.0 37.0 37.0 37.0 84-85 35.63390847711928 37.0 37.0 37.0 37.0 37.0 86-87 35.64541135283821 37.0 37.0 37.0 37.0 37.0 88-89 35.537634408602145 37.0 37.0 37.0 37.0 37.0 90-91 35.59739934983746 37.0 37.0 37.0 37.0 37.0 92-93 35.576644161040264 37.0 37.0 37.0 37.0 37.0 94-95 35.529632408102024 37.0 37.0 37.0 37.0 37.0 96-97 35.51076931563904 37.0 37.0 37.0 37.0 37.0 98-99 35.45452211585712 37.0 37.0 37.0 37.0 37.0 100-101 35.33848163291007 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 5.0 26 16.0 27 18.0 28 29.0 29 34.0 30 59.0 31 82.0 32 98.0 33 171.0 34 247.0 35 451.0 36 2246.0 37 541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.825 12.65 16.6 41.925000000000004 2 27.825 17.775 30.7 23.7 3 26.75 23.45 22.2 27.6 4 28.475 28.249999999999996 18.875 24.4 5 28.4 29.075 21.175 21.349999999999998 6 23.674999999999997 31.75 20.025000000000002 24.55 7 19.475 17.275 39.35 23.9 8 23.3 21.5 24.625 30.575000000000003 9 23.325000000000003 20.5 27.625 28.549999999999997 10-11 25.924999999999997 27.1625 19.725 27.187499999999996 12-13 24.575 22.2 25.337500000000002 27.8875 14-15 23.6875 23.775 25.387500000000003 27.150000000000002 16-17 24.25 24.337500000000002 25.35 26.0625 18-19 24.4875 24.2375 24.1625 27.1125 20-21 24.65 23.7875 25.35 26.2125 22-23 25.0125 24.5625 24.474999999999998 25.95 24-25 24.9 24.3125 24.8625 25.924999999999997 26-27 25.5625 24.55 23.6375 26.25 28-29 25.525 24.6125 23.2875 26.575 30-31 25.3125 24.4375 24.625 25.624999999999996 32-33 26.075 24.587500000000002 23.3125 26.025 34-35 23.5375 25.6 24.2375 26.625 36-37 25.174999999999997 24.025 23.8625 26.937499999999996 38-39 25.087500000000002 24.025 24.3125 26.575 40-41 25.4875 24.099999999999998 24.0625 26.35 42-43 24.7 24.212500000000002 24.887500000000003 26.200000000000003 44-45 25.324999999999996 25.0 23.549999999999997 26.125 46-47 25.0375 24.6625 23.9125 26.387500000000003 48-49 24.275 24.9125 24.587500000000002 26.224999999999998 50-51 24.675 24.6 23.9375 26.787499999999998 52-53 25.85 22.975 23.825 27.35 54-55 24.9375 24.05 23.9375 27.075 56-57 25.650000000000002 23.6375 23.75 26.9625 58-59 25.1875 24.175 24.0125 26.625 60-61 24.95 24.8 24.212500000000002 26.0375 62-63 26.650000000000002 23.8125 24.474999999999998 25.0625 64-65 25.275 23.45 24.45 26.825 66-67 24.625 25.025 24.2 26.150000000000002 68-69 25.775 24.587500000000002 23.5125 26.125 70-71 25.5625 23.6125 24.887500000000003 25.937500000000004 72-73 25.2875 25.2875 23.3125 26.1125 74-75 25.5375 24.4125 23.849999999999998 26.200000000000003 76-77 25.78144536134033 24.356089022255563 23.718429607401852 26.144036009002253 78-79 27.219304826206553 24.81870467616904 22.793198299574893 25.168792198049513 80-81 25.44386096524131 24.88122030507627 23.455863965991497 26.219054763690924 82-83 24.93123280820205 24.793698424606152 24.706176544136035 25.568892223055762 84-85 24.968742185546386 24.63115778944736 23.23080770192548 27.169292323080768 86-87 24.318579644911228 24.406101525381345 23.730932733183295 27.544386096524132 88-89 26.231557889472366 25.506376594148538 22.768192048012004 25.49387346836709 90-91 24.981245311327832 24.618654663665918 24.306076519129782 26.094023505876468 92-93 26.281570392598148 24.20605151287822 23.40585146286572 26.106526631657918 94-95 25.431357839459867 24.58114528632158 24.318579644911228 25.668917229307326 96-97 25.062593890836254 24.44917376064096 24.01101652478718 26.477215823735605 98-99 25.93627015361178 23.25758537514282 24.412847530785832 26.393296940459564 100-101 26.98917886696372 10.630171865054105 29.82176957352005 32.55887969446213 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 1.0 28 3.0 29 3.0 30 6.0 31 9.5 32 13.0 33 16.5 34 21.5 35 29.5 36 44.0 37 57.0 38 66.0 39 81.0 40 94.5 41 122.0 42 138.5 43 140.0 44 156.5 45 164.0 46 156.5 47 157.0 48 163.0 49 160.0 50 153.5 51 146.5 52 132.0 53 120.0 54 130.5 55 129.0 56 127.0 57 120.0 58 92.5 59 96.0 60 91.0 61 73.5 62 82.0 63 81.0 64 64.5 65 52.5 66 51.0 67 55.0 68 51.0 69 46.5 70 46.0 71 46.5 72 49.0 73 40.0 74 29.0 75 21.0 76 17.5 77 21.0 78 14.5 79 5.5 80 3.0 81 2.5 82 1.5 83 2.5 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 4.0 96 2.0 97 22.0 98 65.0 99 299.0 100 930.0 101 2677.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.53236820540836 83.775 2 7.730128380223983 14.149999999999999 3 0.6828735318219066 1.875 4 0.054629882545752524 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351631 spots for SRR21853465.sra Written 351631 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra Read 351627 spots for SRR21853465.sra Written 351627 spots for SRR21853465.sra SRR ids: ['SRR21853465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x02osjpp SRR21853465.sra spots: 7032544 blocks: [[1, 351627], [351628, 703254], [703255, 1054881], [1054882, 1406508], [1406509, 1758135], [1758136, 2109762], [2109763, 2461389], [2461390, 2813016], [2813017, 3164643], [3164644, 3516270], [3516271, 3867897], [3867898, 4219524], [4219525, 4571151], [4571152, 4922778], [4922779, 5274405], [5274406, 5626032], [5626033, 5977659], [5977660, 6329286], [6329287, 6680913], [6680914, 7032544]] SRR21853465 file size 1890809 SRR21853465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853465 SRR21853465_1.fastq Input file: SRR21853465_1.fastq trimmed: SRR21853465-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:27:54 2024 >> started Fri Dec 6 15:27:58 2024 >> done (3.970s) 7032544 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 1767 ( 0.03%) empty reads filtered out after trimming by size control 7030775 (99.97%) reads available; of these: 219 ( 0.00%) trimmed reads available after processing 7030556 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 3 0.00% 33 4 0.00% 34 0 0.00% 35 11 0.00% 36 16 0.00% 37 14 0.00% 38 13 0.00% 39 18 0.00% 40 13 0.00% 41 10 0.00% 42 18 0.00% 43 12 0.00% 44 8 0.00% 45 14 0.00% 46 14 0.00% 47 14 0.00% 48 10 0.00% 49 10 0.00% 50 8 0.00% 51 11 0.00% 52 16 0.00% 53 13 0.00% 54 16 0.00% 55 12 0.00% 56 20 0.00% 57 15 0.00% 58 13 0.00% 59 22 0.00% 60 24 0.00% 61 20 0.00% 62 18 0.00% 63 21 0.00% 64 22 0.00% 65 21 0.00% 66 17 0.00% 67 24 0.00% 68 23 0.00% 69 18 0.00% 70 23 0.00% 71 36 0.00% 72 26 0.00% 73 21 0.00% 74 27 0.00% 75 33 0.00% 76 26 0.00% 77 27 0.00% 78 23 0.00% 79 38 0.00% 80 33 0.00% 81 33 0.00% 82 28 0.00% 83 27 0.00% 84 41 0.00% 85 38 0.00% 86 44 0.00% 87 47 0.00% 88 47 0.00% 89 71 0.00% 90 96 0.00% 91 502 0.01% 92 160 0.00% 93 209 0.00% 94 354 0.01% 95 1396 0.02% 96 8615 0.12% 97 32405 0.46% 98 121432 1.73% 99 468758 6.67% 100 1586083 22.56% 101 4809513 68.41% 7030775 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=12 prefix-density=0.30 prefix-fanout=2.2 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=6.03 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=1.7 sequence=CATCCGACCCGTCTTGAAACACGGACCAAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGGCCGCACCGCTGGCCGACCCTGATCTTCTGTGAAGGGTTCGAGTTGGAGCACGCCTGTCGGGACCCGAAAGATGGTGAACTATGCCTGAGCGGGGCGAAGCCAGAGGAA Started job on | Dec 06 15:28:19 Started mapping on | Dec 06 15:28:20 Finished on | Dec 06 15:28:31 Mapping speed, Million of reads per hour | 2300.98 Number of input reads | 7030775 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5767747 Uniquely mapped reads % | 82.04% Average mapped length | 100.31 Number of splices: Total | 1991413 Number of splices: Annotated (sjdb) | 1883225 Number of splices: GT/AG | 1961916 Number of splices: GC/AG | 26458 Number of splices: AT/AC | 1167 Number of splices: Non-canonical | 1872 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501411 % of reads mapped to multiple loci | 7.13% Number of reads mapped to too many loci | 628023 % of reads mapped to too many loci | 8.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.68% % of reads unmapped: other | 1.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 761617 761617 761617 N_multimapping 501411 501411 501411 N_noFeature 302150 3074452 2918780 N_ambiguous 89465 6360 6989 UnstrandedReadsAssigned:5376132 PositiveStrandReadsAssigned:2686935 NegativeStrandReadsAssigned:2841978 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853465 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853465-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,030,775 reads, 5,678,749 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52973 SRR21853465.ke.tsv 35125 SRR21853465.se.tsv 88098 total ==> SRR21853465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.07281 0.739316 PNS24247 1044 945 25.1443 7.94335 PNS24249 1928 1829 69.4464 11.3353 PNS24246 1044 945 25.1443 7.94335 PNS24248 1044 945 25.1443 7.94335 PNS24244 1471 1372 12.0478 2.6215 PNS24243 293 194 10 15.3884 KQK14069 1603 1504 5758.77 1143.08 KQK14071 474 375 776.051 617.809 ==> SRR21853465.se.tsv <== BRADI_1g14170v3 7232 BRADI_1g53295v3 48 BRADI_1g59795v3 102 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 367 BRADI_1g74790v3 78 BRADI_1g09890v3 2 BRADI_1g77505v3 74 BRADI_1g48960v3 0 SRR21853465 completed mapping pipeline successfully