Starting /dee2/code/volunteer_pipeline.sh SRR21853466 current disk space = 1550341550080 free memory = 1599654280 SRR21853466 SRAfilesize 79331214823abdbdf6e09c24148644d4 SRR21853466.sra SRR21853466.sra file validated SRR21853466 is single end SRR21853466 is conventional basespace SRR21853466 read1 length is 45-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0785 37.0 37.0 37.0 25.0 37.0 2 34.997 37.0 37.0 37.0 25.0 37.0 3 35.44775 37.0 37.0 37.0 37.0 37.0 4 35.5265 37.0 37.0 37.0 37.0 37.0 5 35.6075 37.0 37.0 37.0 37.0 37.0 6 35.6345 37.0 37.0 37.0 37.0 37.0 7 35.538 37.0 37.0 37.0 37.0 37.0 8 35.737 37.0 37.0 37.0 37.0 37.0 9 35.7635 37.0 37.0 37.0 37.0 37.0 10-11 35.783 37.0 37.0 37.0 37.0 37.0 12-13 35.745999999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.801500000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.831999999999994 37.0 37.0 37.0 37.0 37.0 18-19 35.70675 37.0 37.0 37.0 37.0 37.0 20-21 35.733 37.0 37.0 37.0 37.0 37.0 22-23 35.704750000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.62925 37.0 37.0 37.0 37.0 37.0 26-27 35.627250000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.557 37.0 37.0 37.0 37.0 37.0 30-31 35.627750000000006 37.0 37.0 37.0 37.0 37.0 32-33 35.57175 37.0 37.0 37.0 37.0 37.0 34-35 35.47725 37.0 37.0 37.0 37.0 37.0 36-37 35.440749999999994 37.0 37.0 37.0 37.0 37.0 38-39 35.486000000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.40675 37.0 37.0 37.0 37.0 37.0 42-43 35.4055 37.0 37.0 37.0 37.0 37.0 44-45 35.381249999999994 37.0 37.0 37.0 37.0 37.0 46-47 35.397599399849966 37.0 37.0 37.0 37.0 37.0 48-49 35.44086021505376 37.0 37.0 37.0 37.0 37.0 50-51 35.42635658914729 37.0 37.0 37.0 37.0 37.0 52-53 35.459114778694676 37.0 37.0 37.0 37.0 37.0 54-55 35.35933983495874 37.0 37.0 37.0 37.0 37.0 56-57 35.33208302075519 37.0 37.0 37.0 37.0 37.0 58-59 35.47761940485121 37.0 37.0 37.0 37.0 37.0 60-61 35.35233808452113 37.0 37.0 37.0 37.0 37.0 62-63 35.41410352588147 37.0 37.0 37.0 37.0 37.0 64-65 35.437859464866214 37.0 37.0 37.0 37.0 37.0 66-67 35.37984496124031 37.0 37.0 37.0 37.0 37.0 68-69 35.27156789197299 37.0 37.0 37.0 31.0 37.0 70-71 35.28707176794198 37.0 37.0 37.0 31.0 37.0 72-73 35.2785696424106 37.0 37.0 37.0 31.0 37.0 74-75 35.2880720180045 37.0 37.0 37.0 31.0 37.0 76-77 35.211802950737685 37.0 37.0 37.0 31.0 37.0 78-79 35.30832708177044 37.0 37.0 37.0 37.0 37.0 80-81 35.310077519379846 37.0 37.0 37.0 31.0 37.0 82-83 35.29632408102026 37.0 37.0 37.0 25.0 37.0 84-85 35.15328832208052 37.0 37.0 37.0 25.0 37.0 86-87 35.18404601150287 37.0 37.0 37.0 25.0 37.0 88-89 35.23005751437859 37.0 37.0 37.0 31.0 37.0 90-91 35.200100050025014 37.0 37.0 37.0 31.0 37.0 92-93 35.16037027770828 37.0 37.0 37.0 31.0 37.0 94-95 35.131848886665 37.0 37.0 37.0 25.0 37.0 96-97 35.14707813600099 37.0 37.0 37.0 25.0 37.0 98-99 35.04738983757092 37.0 37.0 37.0 25.0 37.0 100-101 35.05774217148064 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 8.0 25 8.0 26 19.0 27 20.0 28 34.0 29 52.0 30 82.0 31 112.0 32 158.0 33 196.0 34 323.0 35 563.0 36 2070.0 37 353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.625 12.325 17.45 41.6 2 26.73067205659424 19.93431025770591 29.585649317837294 23.749368367862555 3 26.581645411352838 22.755688922230558 22.355588897224308 28.307076769192296 4 29.175 29.175 16.825000000000003 24.825 5 28.050000000000004 30.2 19.875 21.875 6 21.9 33.775 19.975 24.349999999999998 7 20.825 16.225 37.824999999999996 25.124999999999996 8 22.25 21.55 25.124999999999996 31.075000000000003 9 22.95 21.175 27.625 28.249999999999996 10-11 26.5625 27.3125 20.2125 25.912499999999998 12-13 25.15 22.400000000000002 25.0625 27.3875 14-15 24.925 24.025 24.712500000000002 26.337500000000002 16-17 26.0375 23.0125 24.8 26.150000000000002 18-19 24.85 24.5375 24.5375 26.075 20-21 25.3 24.712500000000002 24.125 25.8625 22-23 25.224999999999998 24.875 23.75 26.150000000000002 24-25 25.0 25.2625 23.65 26.087500000000002 26-27 25.25 24.1625 23.7 26.887499999999996 28-29 25.412499999999998 24.55 24.175 25.8625 30-31 24.65 24.3625 24.375 26.6125 32-33 25.75 24.5125 24.2 25.5375 34-35 25.337500000000002 24.5625 24.0625 26.0375 36-37 25.912499999999998 24.3625 23.962500000000002 25.7625 38-39 26.05 23.4375 25.0 25.5125 40-41 25.4 24.3875 23.7625 26.450000000000003 42-43 25.025 24.337500000000002 25.4375 25.2 44-45 25.2625 23.3 24.275 27.1625 46-47 25.36884221055264 23.34333583395849 23.93098274568642 27.35683920980245 48-49 25.206301575393848 23.380845211302827 25.018754688672168 26.39409852463116 50-51 26.344086021505376 24.193548387096776 23.830957739434858 25.63140785196299 52-53 26.38159539884971 23.34333583395849 23.680920230057513 26.59414853713428 54-55 24.81870467616904 25.18129532383096 23.55588897224306 26.44411102775694 56-57 25.49387346836709 24.69367341835459 23.95598899724931 25.85646411602901 58-59 26.556639159789945 24.131032758189548 23.468367091772944 25.84396099024756 60-61 25.268817204301076 24.293573393348336 24.58114528632158 25.85646411602901 62-63 26.431607901975497 23.980995248812203 23.755938984746187 25.831457864466117 64-65 25.6064016004001 24.656164041010253 23.355838959739934 26.38159539884971 66-67 26.156539134783696 23.543385846461614 24.031007751937985 26.269067266816705 68-69 26.006501625406354 24.493623405851466 23.943485871467868 25.55638909727432 70-71 24.668667166791696 24.48112028007002 23.34333583395849 27.506876719179797 72-73 25.23130782695674 25.156289072268066 24.20605151287822 25.406351587896975 74-75 24.69367341835459 24.10602650662666 24.318579644911228 26.881720430107524 76-77 27.156789197299325 22.943235808952238 23.868467116779193 26.03150787696924 78-79 25.29382345586397 24.243560890222557 24.50612653163291 25.95648912228057 80-81 26.91922980745186 24.518629657414355 22.918229557389346 25.64391097774444 82-83 25.068767191797946 24.343585896474117 24.756189047261813 25.831457864466117 84-85 24.968742185546386 24.48112028007002 23.793448362090523 26.756689172293076 86-87 25.55638909727432 24.131032758189548 23.968492123030757 26.344086021505376 88-89 26.219054763690924 24.006001500375092 23.468367091772944 26.30657664416104 90-91 25.287643821910955 23.82441220610305 24.562281140570285 26.32566283141571 92-93 26.09457092819615 24.080560420315237 24.48086064548411 25.344008006004504 94-95 25.2064048036027 24.49337002752064 24.0180135101326 26.28221165874406 96-97 24.949899799599198 25.37575150300601 24.461422845691384 25.212925851703403 98-99 26.135062953071348 23.604222307007504 25.054050616812923 25.20666412310823 100-101 26.79509632224168 11.112880114631428 29.437987581595287 32.65403598153161 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 0.5 28 2.5 29 4.5 30 4.5 31 5.5 32 9.5 33 9.5 34 15.5 35 33.5 36 42.5 37 50.5 38 62.5 39 79.0 40 102.5 41 116.5 42 123.0 43 139.0 44 169.0 45 174.5 46 151.5 47 153.0 48 175.5 49 175.5 50 149.0 51 139.0 52 141.0 53 144.0 54 146.0 55 137.0 56 124.0 57 114.0 58 102.0 59 84.0 60 73.5 61 65.5 62 64.5 63 66.0 64 65.5 65 65.0 66 62.5 67 59.5 68 54.0 69 49.0 70 52.5 71 57.5 72 43.5 73 33.0 74 30.5 75 21.0 76 19.0 77 13.5 78 8.5 79 8.5 80 4.5 81 2.5 82 2.0 83 1.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.05 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 44-45 1.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 1.0 92-93 0.0 94-95 3.0 96-97 26.0 98-99 394.0 100-101 3574.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.67043923470763 85.975 2 6.898410132039881 12.8 3 0.40420371867421184 1.125 4 0.026946914578280787 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702602 spots for SRR21853466.sra Written 702602 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra Read 702601 spots for SRR21853466.sra Written 702601 spots for SRR21853466.sra SRR ids: ['SRR21853466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wfw09n9n SRR21853466.sra spots: 14052021 blocks: [[1, 702601], [702602, 1405202], [1405203, 2107803], [2107804, 2810404], [2810405, 3513005], [3513006, 4215606], [4215607, 4918207], [4918208, 5620808], [5620809, 6323409], [6323410, 7026010], [7026011, 7728611], [7728612, 8431212], [8431213, 9133813], [9133814, 9836414], [9836415, 10539015], [10539016, 11241616], [11241617, 11944217], [11944218, 12646818], [12646819, 13349419], [13349420, 14052021]] SRR21853466 file size 3782896 SRR21853466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853466 SRR21853466_1.fastq Input file: SRR21853466_1.fastq trimmed: SRR21853466-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:29:59 2024 >> started Fri Dec 6 15:30:06 2024 >> done (7.044s) 14052021 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 5626 ( 0.04%) empty reads filtered out after trimming by size control 14046388 (99.96%) reads available; of these: 216 ( 0.00%) trimmed reads available after processing 14046172 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 0 0.00% 29 5 0.00% 30 3 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 4 0.00% 35 52 0.00% 36 41 0.00% 37 41 0.00% 38 49 0.00% 39 55 0.00% 40 51 0.00% 41 57 0.00% 42 50 0.00% 43 60 0.00% 44 40 0.00% 45 57 0.00% 46 53 0.00% 47 65 0.00% 48 49 0.00% 49 72 0.00% 50 71 0.00% 51 71 0.00% 52 65 0.00% 53 53 0.00% 54 58 0.00% 55 46 0.00% 56 67 0.00% 57 72 0.00% 58 69 0.00% 59 71 0.00% 60 101 0.00% 61 84 0.00% 62 87 0.00% 63 90 0.00% 64 97 0.00% 65 90 0.00% 66 84 0.00% 67 83 0.00% 68 92 0.00% 69 91 0.00% 70 88 0.00% 71 105 0.00% 72 108 0.00% 73 90 0.00% 74 108 0.00% 75 104 0.00% 76 126 0.00% 77 105 0.00% 78 104 0.00% 79 124 0.00% 80 132 0.00% 81 145 0.00% 82 117 0.00% 83 148 0.00% 84 143 0.00% 85 165 0.00% 86 143 0.00% 87 210 0.00% 88 174 0.00% 89 218 0.00% 90 310 0.00% 91 1157 0.01% 92 388 0.00% 93 506 0.00% 94 822 0.01% 95 3122 0.02% 96 17428 0.12% 97 64154 0.46% 98 245538 1.75% 99 939147 6.69% 100 3171313 22.58% 101 9597481 68.33% 14046388 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=2.2 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=6.02 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=2.6 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 15:30:25 Started mapping on | Dec 06 15:30:26 Finished on | Dec 06 15:30:45 Mapping speed, Million of reads per hour | 2661.42 Number of input reads | 14046388 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11529467 Uniquely mapped reads % | 82.08% Average mapped length | 100.28 Number of splices: Total | 4003746 Number of splices: Annotated (sjdb) | 3785811 Number of splices: GT/AG | 3943459 Number of splices: GC/AG | 53874 Number of splices: AT/AC | 2260 Number of splices: Non-canonical | 4153 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.69 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1009937 % of reads mapped to multiple loci | 7.19% Number of reads mapped to too many loci | 1214117 % of reads mapped to too many loci | 8.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 1.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1506984 1506984 1506984 N_multimapping 1009937 1009937 1009937 N_noFeature 602681 6130120 5847836 N_ambiguous 179766 12678 14014 UnstrandedReadsAssigned:10747020 PositiveStrandReadsAssigned:5386669 NegativeStrandReadsAssigned:5667617 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853466 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853466-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,046,388 reads, 11,344,701 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,243 rounds 52973 SRR21853466.ke.tsv 35125 SRR21853466.se.tsv 88098 total ==> SRR21853466.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 3.51532 0.625824 PNS24247 1044 945 47.6456 7.51283 PNS24249 1928 1829 151.33 12.3289 PNS24246 1044 945 47.6456 7.51283 PNS24248 1044 945 47.6456 7.51283 PNS24244 1471 1372 32.2174 3.49904 PNS24243 293 194 23 17.666 KQK14069 1603 1504 11888.5 1177.85 KQK14071 474 375 1705.94 677.866 ==> SRR21853466.se.tsv <== BRADI_1g14170v3 14683 BRADI_1g53295v3 88 BRADI_1g59795v3 211 BRADI_1g07683v3 0 BRADI_1g00485v3 35 BRADI_1g20270v3 701 BRADI_1g74790v3 167 BRADI_1g09890v3 3 BRADI_1g77505v3 181 BRADI_1g48960v3 0 SRR21853466 completed mapping pipeline successfully