Starting /dee2/code/volunteer_pipeline.sh SRR21853467 current disk space = 1550409256960 free memory = 1599655284 SRR21853467 SRAfilesize 60a2b1342c62f141f65d522c4330a306 SRR21853467.sra SRR21853467.sra file validated SRR21853467 is single end SRR21853467 is conventional basespace SRR21853467 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.17725 37.0 37.0 37.0 25.0 37.0 2 35.66875 37.0 37.0 37.0 37.0 37.0 3 35.84475 37.0 37.0 37.0 37.0 37.0 4 35.70325 37.0 37.0 37.0 37.0 37.0 5 36.03375 37.0 37.0 37.0 37.0 37.0 6 35.93525 37.0 37.0 37.0 37.0 37.0 7 35.79825 37.0 37.0 37.0 37.0 37.0 8 35.90725 37.0 37.0 37.0 37.0 37.0 9 35.82675 37.0 37.0 37.0 37.0 37.0 10-11 35.9645 37.0 37.0 37.0 37.0 37.0 12-13 35.9135 37.0 37.0 37.0 37.0 37.0 14-15 35.8795 37.0 37.0 37.0 37.0 37.0 16-17 35.78075 37.0 37.0 37.0 37.0 37.0 18-19 35.857 37.0 37.0 37.0 37.0 37.0 20-21 35.711 37.0 37.0 37.0 37.0 37.0 22-23 35.843 37.0 37.0 37.0 37.0 37.0 24-25 35.733999999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.54900000000001 37.0 37.0 37.0 37.0 37.0 28-29 35.71075 37.0 37.0 37.0 37.0 37.0 30-31 35.554249999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.6065 37.0 37.0 37.0 37.0 37.0 34-35 35.517250000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.5778944736184 37.0 37.0 37.0 37.0 37.0 38-39 35.68067016754189 37.0 37.0 37.0 37.0 37.0 40-41 35.70792698174543 37.0 37.0 37.0 37.0 37.0 42-43 35.71217804451113 37.0 37.0 37.0 37.0 37.0 44-45 35.499374843710925 37.0 37.0 37.0 37.0 37.0 46-47 35.652163040760186 37.0 37.0 37.0 37.0 37.0 48-49 35.54563640910227 37.0 37.0 37.0 37.0 37.0 50-51 35.503375843960995 37.0 37.0 37.0 37.0 37.0 52-53 35.50887721930482 37.0 37.0 37.0 37.0 37.0 54-55 35.50687671917979 37.0 37.0 37.0 37.0 37.0 56-57 35.58814703675919 37.0 37.0 37.0 37.0 37.0 58-59 35.47911977994498 37.0 37.0 37.0 37.0 37.0 60-61 35.46911727931983 37.0 37.0 37.0 37.0 37.0 62-63 35.426106526631656 37.0 37.0 37.0 37.0 37.0 64-65 35.58714678669668 37.0 37.0 37.0 37.0 37.0 66-67 35.54613653413354 37.0 37.0 37.0 37.0 37.0 68-69 35.533883470867714 37.0 37.0 37.0 37.0 37.0 70-71 35.55913978494624 37.0 37.0 37.0 37.0 37.0 72-73 35.4948737184296 37.0 37.0 37.0 37.0 37.0 74-75 35.312828207051766 37.0 37.0 37.0 37.0 37.0 76-77 35.468117029257314 37.0 37.0 37.0 37.0 37.0 78-79 35.44686171542885 37.0 37.0 37.0 37.0 37.0 80-81 35.45336334083521 37.0 37.0 37.0 37.0 37.0 82-83 35.49312328082021 37.0 37.0 37.0 37.0 37.0 84-85 35.37934483620905 37.0 37.0 37.0 31.0 37.0 86-87 35.38684671167792 37.0 37.0 37.0 37.0 37.0 88-89 35.37809452363091 37.0 37.0 37.0 37.0 37.0 90-91 35.38734683670918 37.0 37.0 37.0 37.0 37.0 92-93 35.45190018114834 37.0 37.0 37.0 37.0 37.0 94-95 35.47773886943472 37.0 37.0 37.0 37.0 37.0 96-97 35.41209741291171 37.0 37.0 37.0 37.0 37.0 98-99 35.368857989354424 37.0 37.0 37.0 37.0 37.0 100-101 35.14760418904153 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 2.0 24 5.0 25 9.0 26 13.0 27 23.0 28 32.0 29 42.0 30 72.0 31 100.0 32 137.0 33 166.0 34 274.0 35 518.0 36 2124.0 37 480.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.981745436359088 12.353088272068018 16.30407601900475 44.36109027256814 2 25.331332833208304 19.72993248312078 30.43260815203801 24.50612653163291 3 26.531632908227053 22.73068267066767 22.13053263315829 28.60715178794699 4 27.056764191047762 27.85696424106027 18.079519879969993 27.00675168792198 5 28.232058014503625 29.957489372343087 20.230057514378593 21.580395098774694 6 22.20555138784696 32.98324581145287 20.305076269067268 24.50612653163291 7 21.13028257064266 15.65391347836959 37.83445861465366 25.381345336334082 8 23.730932733183295 20.855213803450862 23.78094523630908 31.632908227056767 9 21.630407601900476 21.630407601900476 26.63165791447862 30.107526881720432 10-11 25.881470367591895 27.144286071517882 19.129782445611404 27.84446111527882 12-13 24.118529632408105 21.555388847211805 25.543885971492873 28.782195548887223 14-15 24.568642160540136 24.50612653163291 24.381095273818453 26.544136034008503 16-17 24.718679669917478 23.868467116779193 23.718429607401852 27.694423605901473 18-19 25.018754688672168 24.618654663665918 23.455863965991497 26.906726681670417 20-21 26.206551637909474 24.20605151287822 23.268317079269817 26.319079769942487 22-23 25.918979744936234 23.518379594898725 23.980995248812203 26.581645411352838 24-25 24.143535883970994 24.618654663665918 23.48087021755439 27.7569392348087 26-27 25.393848462115532 24.406101525381345 23.680920230057513 26.51912978244561 28-29 25.481370342585645 24.18104526131533 23.418354588647162 26.91922980745186 30-31 24.518629657414355 24.20605151287822 23.69342335583896 27.581895473868467 32-33 25.568892223055762 24.843710927731934 22.918229557389346 26.669167291822955 34-35 24.593648412103025 24.5311327831958 23.718429607401852 27.156789197299325 36-37 25.693923480870218 23.943485871467868 23.85596399099775 26.506626656664167 38-39 26.019004751187797 23.25581395348837 23.10577644411103 27.619404851212803 40-41 25.63140785196299 24.418604651162788 21.99299824956239 27.956989247311824 42-43 25.206301575393848 24.468617154288573 23.0432608152038 27.28182045511378 44-45 25.381345336334082 24.356089022255563 23.568392098024507 26.694173543385848 46-47 25.84396099024756 24.981245311327832 22.61815453863466 26.556639159789945 48-49 25.543885971492873 24.23105776444111 23.95598899724931 26.269067266816705 50-51 25.84396099024756 24.718679669917478 22.95573893473368 26.481620405101275 52-53 25.418854713678417 24.281070267566893 23.443360840210055 26.85671417854464 54-55 25.243810952738183 25.068767191797946 23.068267066766694 26.619154788697173 56-57 25.681420355088775 24.643660915228807 22.780695173793447 26.894223555888974 58-59 26.219054763690924 23.74343585896474 23.418354588647162 26.619154788697173 60-61 24.981245311327832 24.01850462615654 23.643410852713178 27.35683920980245 62-63 25.11877969492373 24.381095273818453 23.393348337084273 27.106776694173547 64-65 26.406601650412604 23.830957739434858 22.50562640660165 27.25681420355089 66-67 25.28132033008252 23.63090772693173 24.168542135533883 26.91922980745186 68-69 27.081770442610654 22.843210802700675 22.893223305826456 27.181795448862218 70-71 25.318829707426854 24.44361090272568 23.20580145036259 27.031757939484873 72-73 25.98149537384346 23.643410852713178 23.99349837459365 26.38159539884971 74-75 26.481620405101275 22.593148287071767 23.830957739434858 27.094273568392097 76-77 26.356589147286826 23.093273318329583 23.268317079269817 27.28182045511378 78-79 25.64391097774444 23.58089522380595 24.131032758189548 26.644161040260066 80-81 25.993998499624904 24.69367341835459 22.755688922230558 26.556639159789945 82-83 25.93148287071768 24.381095273818453 22.568142035508878 27.11927981995499 84-85 24.943735933983497 24.06851712928232 23.48087021755439 27.506876719179797 86-87 25.70642660665166 22.968242060515127 23.74343585896474 27.581895473868467 88-89 25.818954738684667 23.980995248812203 23.355838959739934 26.84421105276319 90-91 26.581645411352838 23.23080770192548 23.543385846461614 26.644161040260066 92-93 25.559584844316618 24.434162811054144 23.446292359634864 26.559959984994375 94-95 26.813406703351678 23.13656828414207 22.611305652826413 27.43871935967984 96-97 25.159514575253343 23.382960090078818 23.94595270862004 27.51157262604779 98-99 25.689698810427743 23.22196912174133 23.31055429005315 27.77777777777778 100-101 28.223540430846082 9.94380268498283 28.114267873868247 33.71838901030284 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 2.5 28 3.0 29 4.0 30 5.5 31 6.0 32 8.0 33 12.5 34 17.5 35 29.0 36 41.0 37 52.0 38 65.0 39 72.0 40 88.5 41 106.0 42 130.5 43 157.0 44 159.0 45 147.0 46 153.0 47 168.5 48 158.0 49 154.0 50 154.5 51 130.5 52 110.5 53 110.5 54 108.0 55 100.0 56 100.0 57 102.5 58 94.5 59 91.0 60 88.5 61 81.5 62 80.0 63 76.0 64 80.5 65 77.5 66 71.5 67 78.5 68 75.0 69 66.0 70 67.5 71 60.5 72 48.0 73 44.0 74 41.0 75 31.5 76 23.0 77 23.0 78 17.5 79 12.5 80 6.5 81 2.0 82 1.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 1.0 94-95 0.0 96-97 24.0 98-99 315.0 100-101 3659.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.15515409139213 88.6 2 5.419766206163656 10.2 3 0.4250797024442083 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0125 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539006 spots for SRR21853467.sra Written 539006 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra Read 539004 spots for SRR21853467.sra Written 539004 spots for SRR21853467.sra SRR ids: ['SRR21853467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iywrl_o5 SRR21853467.sra spots: 10780082 blocks: [[1, 539004], [539005, 1078008], [1078009, 1617012], [1617013, 2156016], [2156017, 2695020], [2695021, 3234024], [3234025, 3773028], [3773029, 4312032], [4312033, 4851036], [4851037, 5390040], [5390041, 5929044], [5929045, 6468048], [6468049, 7007052], [7007053, 7546056], [7546057, 8085060], [8085061, 8624064], [8624065, 9163068], [9163069, 9702072], [9702073, 10241076], [10241077, 10780082]] SRR21853467 file size 2898833 SRR21853467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853467 SRR21853467_1.fastq Input file: SRR21853467_1.fastq trimmed: SRR21853467-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:31:40 2024 >> started Fri Dec 6 15:31:46 2024 >> done (5.934s) 10780082 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 22079 ( 0.20%) empty reads filtered out after trimming by size control 10757948 (99.79%) reads available; of these: 467 ( 0.00%) trimmed reads available after processing 10757481 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 1 0.00% 24 6 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 5 0.00% 29 1 0.00% 30 3 0.00% 31 2 0.00% 32 9 0.00% 33 13 0.00% 34 4 0.00% 35 106 0.00% 36 111 0.00% 37 108 0.00% 38 106 0.00% 39 98 0.00% 40 125 0.00% 41 87 0.00% 42 96 0.00% 43 96 0.00% 44 121 0.00% 45 108 0.00% 46 104 0.00% 47 130 0.00% 48 94 0.00% 49 127 0.00% 50 101 0.00% 51 106 0.00% 52 110 0.00% 53 120 0.00% 54 122 0.00% 55 104 0.00% 56 110 0.00% 57 122 0.00% 58 126 0.00% 59 124 0.00% 60 146 0.00% 61 130 0.00% 62 120 0.00% 63 132 0.00% 64 147 0.00% 65 141 0.00% 66 140 0.00% 67 110 0.00% 68 151 0.00% 69 126 0.00% 70 132 0.00% 71 147 0.00% 72 140 0.00% 73 160 0.00% 74 151 0.00% 75 172 0.00% 76 203 0.00% 77 165 0.00% 78 198 0.00% 79 171 0.00% 80 165 0.00% 81 201 0.00% 82 198 0.00% 83 216 0.00% 84 180 0.00% 85 200 0.00% 86 195 0.00% 87 210 0.00% 88 224 0.00% 89 285 0.00% 90 298 0.00% 91 545 0.01% 92 292 0.00% 93 384 0.00% 94 787 0.01% 95 2870 0.03% 96 14628 0.14% 97 47103 0.44% 98 184775 1.72% 99 708466 6.59% 100 2348396 21.83% 101 7441516 69.17% 10757948 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=19 prefix-density=0.35 prefix-fanout=1.9 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=223.29 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=23.4 sequence=CCGCCGCCGCCA Started job on | Dec 06 15:32:02 Started mapping on | Dec 06 15:32:02 Finished on | Dec 06 15:32:19 Mapping speed, Million of reads per hour | 2278.15 Number of input reads | 10757948 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 10155773 Uniquely mapped reads % | 94.40% Average mapped length | 100.31 Number of splices: Total | 3460874 Number of splices: Annotated (sjdb) | 3285231 Number of splices: GT/AG | 3414340 Number of splices: GC/AG | 41585 Number of splices: AT/AC | 1832 Number of splices: Non-canonical | 3117 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 287303 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 190327 % of reads mapped to too many loci | 1.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314872 314872 314872 N_multimapping 287303 287303 287303 N_noFeature 345676 5308457 5061887 N_ambiguous 152230 12567 9660 UnstrandedReadsAssigned:9657867 PositiveStrandReadsAssigned:4834749 NegativeStrandReadsAssigned:5084226 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853467 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853467-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,757,948 reads, 9,929,937 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR21853467.ke.tsv 35125 SRR21853467.se.tsv 88098 total ==> SRR21853467.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 3.41901 0.687456 PNS24247 1044 945 25.0219 4.45615 PNS24249 1928 1829 94.7569 8.71901 PNS24246 1044 945 25.0219 4.45615 PNS24248 1044 945 25.0219 4.45615 PNS24244 1471 1372 7.75831 0.951663 PNS24243 293 194 13 11.2775 KQK14069 1603 1504 2135.6 238.969 KQK14071 474 375 214.129 96.0979 ==> SRR21853467.se.tsv <== BRADI_1g14170v3 2527 BRADI_1g53295v3 59 BRADI_1g59795v3 136 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1197 BRADI_1g74790v3 138 BRADI_1g09890v3 4 BRADI_1g77505v3 104 BRADI_1g48960v3 0 SRR21853467 completed mapping pipeline successfully