Starting /dee2/code/volunteer_pipeline.sh SRR21853468 current disk space = 1516051394560 free memory = 1570825968 SRR21853468 SRAfilesize 32a618c3fbbb0e9faf4ab33e5bb854a8 SRR21853468.sra SRR21853468.sra file validated SRR21853468 is single end SRR21853468 is conventional basespace SRR21853468 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.7095 37.0 37.0 37.0 25.0 37.0 2 34.908 37.0 37.0 37.0 25.0 37.0 3 35.24475 37.0 37.0 37.0 25.0 37.0 4 35.3445 37.0 37.0 37.0 37.0 37.0 5 35.627 37.0 37.0 37.0 37.0 37.0 6 35.4575 37.0 37.0 37.0 37.0 37.0 7 35.2875 37.0 37.0 37.0 37.0 37.0 8 35.471 37.0 37.0 37.0 37.0 37.0 9 35.4745 37.0 37.0 37.0 37.0 37.0 10-11 35.639250000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.61875 37.0 37.0 37.0 37.0 37.0 14-15 35.5265 37.0 37.0 37.0 37.0 37.0 16-17 35.64325 37.0 37.0 37.0 37.0 37.0 18-19 35.524 37.0 37.0 37.0 37.0 37.0 20-21 35.50825 37.0 37.0 37.0 37.0 37.0 22-23 35.50675 37.0 37.0 37.0 37.0 37.0 24-25 35.465999999999994 37.0 37.0 37.0 37.0 37.0 26-27 35.25975 37.0 37.0 37.0 37.0 37.0 28-29 35.319500000000005 37.0 37.0 37.0 37.0 37.0 30-31 35.301 37.0 37.0 37.0 37.0 37.0 32-33 35.283249999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.382 37.0 37.0 37.0 37.0 37.0 36-37 35.23059589384076 37.0 37.0 37.0 31.0 37.0 38-39 35.23009514271407 37.0 37.0 37.0 25.0 37.0 40-41 35.314221331998 37.0 37.0 37.0 31.0 37.0 42-43 35.23087887528764 37.0 37.0 37.0 31.0 37.0 44-45 35.190333082895066 37.0 37.0 37.0 25.0 37.0 46-47 35.304032056098166 37.0 37.0 37.0 37.0 37.0 48-49 35.1587778612572 37.0 37.0 37.0 25.0 37.0 50-51 35.291760581016774 37.0 37.0 37.0 31.0 37.0 52-53 35.162534435261705 37.0 37.0 37.0 25.0 37.0 54-55 35.1923365890308 37.0 37.0 37.0 25.0 37.0 56-57 35.11870773854245 37.0 37.0 37.0 25.0 37.0 58-59 35.18081642875032 37.0 37.0 37.0 25.0 37.0 60-61 35.09065865264212 37.0 37.0 37.0 25.0 37.0 62-63 35.1267217630854 37.0 37.0 37.0 25.0 37.0 64-65 35.27780561122245 37.0 37.0 37.0 37.0 37.0 66-67 35.04734468937876 37.0 37.0 37.0 25.0 37.0 68-69 35.1748496993988 37.0 37.0 37.0 31.0 37.0 70-71 34.844689378757515 37.0 37.0 37.0 25.0 37.0 72-73 34.985721442885776 37.0 37.0 37.0 25.0 37.0 74-75 35.02379759519038 37.0 37.0 37.0 25.0 37.0 76-77 34.985721442885776 37.0 37.0 37.0 25.0 37.0 78-79 35.00501002004008 37.0 37.0 37.0 25.0 37.0 80-81 34.98046092184369 37.0 37.0 37.0 25.0 37.0 82-83 35.02429859719439 37.0 37.0 37.0 25.0 37.0 84-85 34.769789579158314 37.0 37.0 37.0 25.0 37.0 86-87 35.03331663326654 37.0 37.0 37.0 25.0 37.0 88-89 34.96317221011806 37.0 37.0 37.0 25.0 37.0 90-91 34.972688549235784 37.0 37.0 37.0 25.0 37.0 92-93 34.85141568529191 37.0 37.0 37.0 25.0 37.0 94-95 34.83331819144251 37.0 37.0 37.0 25.0 37.0 96-97 34.85288183891941 37.0 37.0 37.0 25.0 37.0 98-99 34.89998582210008 37.0 37.0 37.0 25.0 37.0 100-101 34.72064772402875 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 5.0 23 4.0 24 5.0 25 13.0 26 20.0 27 26.0 28 49.0 29 76.0 30 98.0 31 134.0 32 168.0 33 244.0 34 300.0 35 568.0 36 1923.0 37 359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.290936404606907 12.118177265898849 17.40110165247872 43.189784677015524 2 26.695128076343543 18.45806127574083 31.215469613259668 23.63134103465595 3 27.02228900576008 21.96343601302279 22.71475081392437 28.299524167292763 4 28.24236354531798 28.14221331997997 17.826740110165247 25.78868302453681 5 29.018527791687532 28.943415122684023 19.82974461692539 22.208312468703053 6 23.25988983475213 31.69754631947922 18.87831747621432 26.164246369554334 7 21.607411116675014 16.675012518778168 35.803705558337505 25.913870806209317 8 23.71056584877316 22.25838758137206 23.510265398097147 30.520781171757637 9 23.71056584877316 18.352528793189784 27.891837756634953 30.045067601402103 10-11 25.913870806209317 27.391086629944915 19.341512268402607 27.353530295443164 12-13 24.211316975463195 21.532298447671508 24.787180771156734 29.46920380570856 14-15 24.3114672008012 23.87330996494742 24.14872308462694 27.666499749624435 16-17 25.550826239359036 23.272408612919378 23.485227841762644 27.691537305958942 18-19 25.112669003505257 23.547821732598898 24.336504757135703 27.003004506760142 20-21 26.139208813219827 23.685528292438658 22.921882824236352 27.25338007010516 22-23 25.262894341512272 23.635453179769655 24.56184276414622 26.53980971457186 24-25 25.876314471707563 23.322483725588384 23.535302954431646 27.265898848272407 26-27 25.350525788683026 24.536805207811717 22.43365047571357 27.679018527791687 28-29 25.650976464697045 24.098647971957938 23.397596394591886 26.852779168753127 30-31 26.02653980971457 23.635453179769655 23.823234852278418 26.514772158237353 32-33 25.112669003505257 25.425638457686528 22.408612919379067 27.053079619429145 34-35 25.701051577366048 23.760640961442164 23.197295943915876 27.341011517275916 36-37 25.40060090135203 24.13620430645969 23.272408612919378 27.190786179268905 38-39 25.7386079118678 24.086129193790686 23.73560340510766 26.43965948923385 40-41 26.251877816725088 23.347521281922884 23.172258387581373 27.228342513770652 42-43 25.20345561537499 23.751095530236636 23.638412420182796 27.407036434205583 44-45 26.120711244678184 23.42849987478087 23.716503881793138 26.73428499874781 46-47 26.170798898071624 23.203105434510395 23.453543701477585 27.172551965940393 48-49 25.144002003506138 24.34259954921112 22.464312546957174 28.049085900325572 50-51 25.732531930879038 24.092161282243925 23.39093413473579 26.784372652141247 52-53 25.08139243676434 24.167292762334082 23.31580265464563 27.435512146255945 54-55 27.222639619333833 22.426746806912096 22.814926120711245 27.535687453042822 56-57 25.88279489105935 23.478587528174305 23.86676684197345 26.771850738792885 58-59 26.02053593789131 23.36589030803907 23.328324567993988 27.28524918607563 60-61 25.181567743551213 23.779113448534936 23.70398196844478 27.335336839469072 62-63 24.68069120961683 23.491109441522664 24.079639368895567 27.748559979964938 64-65 25.93937875751503 24.02304609218437 22.958416833667332 27.07915831663327 66-67 25.58867735470942 23.246492985971944 23.72244488977956 27.44238476953908 68-69 26.22745490981964 23.09619238476954 23.08366733466934 27.59268537074148 70-71 26.252505010020037 24.486472945891784 22.833166332665332 26.427855711422843 72-73 25.97695390781563 23.371743486973948 23.246492985971944 27.404809619238478 74-75 25.501002004008015 24.586673346693384 23.208917835671343 26.703406813627257 76-77 26.603206412825653 23.922845691382765 22.344689378757515 27.129258517034067 78-79 26.290080160320638 23.22144288577154 23.38426853707415 27.104208416833668 80-81 27.26703406813627 23.446893787575153 22.833166332665332 26.452905811623246 82-83 25.701402805611224 23.321643286573146 22.88326653306613 28.0936873747495 84-85 25.67635270541082 22.645290581162325 23.659819639278556 28.0185370741483 86-87 25.651302605210418 23.40931863727455 23.371743486973948 27.56763527054108 88-89 26.669171990479768 23.512463985970186 23.02392584241513 26.79443818113491 90-91 25.85818090704084 23.465296918065647 23.202204961162614 27.47431721373089 92-93 26.48459032823854 23.264845903282385 23.690804309696816 26.55975945878226 94-95 26.60734427873167 23.49918536157413 22.922672014036845 26.97079834565735 96-97 26.320411491657257 23.447497177267596 23.08367833396061 27.14841299711454 98-99 26.929936305732483 22.738853503184714 23.579617834394902 26.751592356687897 100-101 28.010718789407314 10.182849936948298 26.954602774274903 34.85182849936948 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 1.5 29 3.0 30 4.0 31 5.5 32 10.5 33 14.5 34 24.5 35 31.0 36 32.5 37 42.0 38 46.5 39 58.0 40 89.5 41 103.0 42 117.5 43 137.5 44 146.0 45 161.5 46 169.5 47 168.0 48 164.0 49 162.5 50 146.5 51 130.5 52 121.0 53 111.0 54 105.5 55 104.0 56 90.0 57 84.0 58 97.5 59 103.5 60 100.0 61 87.0 62 84.0 63 85.0 64 82.0 65 81.5 66 70.5 67 75.0 68 79.0 69 62.0 70 62.0 71 66.5 72 59.0 73 43.0 74 33.0 75 28.5 76 26.0 77 23.5 78 15.5 79 13.0 80 12.5 81 8.5 82 6.0 83 2.5 84 2.0 85 1.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.44999999999999996 3 0.17500000000000002 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-11 0.15 12-13 0.15 14-15 0.15 16-17 0.15 18-19 0.15 20-21 0.15 22-23 0.15 24-25 0.15 26-27 0.15 28-29 0.15 30-31 0.15 32-33 0.15 34-35 0.15 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 6.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 1.0 90-91 0.0 92-93 1.0 94-95 1.0 96-97 27.0 98-99 346.0 100-101 3616.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.175 #Duplication Level Percentage of deduplicated Percentage of total 1 93.31902334317145 86.95 2 6.3053394150791515 11.75 3 0.29514354708881135 0.8250000000000001 4 0.026831231553528307 0.1 5 0.0 0.0 6 0.026831231553528307 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026831231553528307 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 36bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.025 28-29 0.025 0.0 0.0 0.0 0.025 30-31 0.025 0.0 0.0 0.0 0.025 32-33 0.025 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.05 0.0 0.0 0.0 0.025 74-75 0.05 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.05 0.0 0.0 0.0 0.025 80-81 0.05 0.0 0.0 0.0 0.025 82-83 0.05 0.0 0.0 0.0 0.025 84-85 0.05 0.0 0.0 0.0 0.025 86-87 0.05 0.0 0.0 0.0 0.025 88-89 0.05 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170673 spots for SRR21853468.sra Written 170673 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra Read 170668 spots for SRR21853468.sra Written 170668 spots for SRR21853468.sra SRR ids: ['SRR21853468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w0ch7s2d SRR21853468.sra spots: 3413365 blocks: [[1, 170668], [170669, 341336], [341337, 512004], [512005, 682672], [682673, 853340], [853341, 1024008], [1024009, 1194676], [1194677, 1365344], [1365345, 1536012], [1536013, 1706680], [1706681, 1877348], [1877349, 2048016], [2048017, 2218684], [2218685, 2389352], [2389353, 2560020], [2560021, 2730688], [2730689, 2901356], [2901357, 3072024], [3072025, 3242692], [3242693, 3413365]] SRR21853468 file size 916512 SRR21853468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853468 SRR21853468_1.fastq Input file: SRR21853468_1.fastq trimmed: SRR21853468-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 02:08:47 2024 >> started Thu Dec 12 02:08:49 2024 >> done (2.035s) 3413365 reads processed; of these: 34 ( 0.00%) short reads filtered out after trimming by size control 12490 ( 0.37%) empty reads filtered out after trimming by size control 3400841 (99.63%) reads available; of these: 177 ( 0.01%) trimmed reads available after processing 3400664 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 4 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 1 0.00% 29 3 0.00% 30 2 0.00% 31 1 0.00% 32 4 0.00% 33 6 0.00% 34 2 0.00% 35 59 0.00% 36 70 0.00% 37 62 0.00% 38 54 0.00% 39 55 0.00% 40 77 0.00% 41 71 0.00% 42 61 0.00% 43 61 0.00% 44 51 0.00% 45 69 0.00% 46 69 0.00% 47 57 0.00% 48 78 0.00% 49 66 0.00% 50 74 0.00% 51 59 0.00% 52 77 0.00% 53 80 0.00% 54 71 0.00% 55 76 0.00% 56 72 0.00% 57 81 0.00% 58 78 0.00% 59 78 0.00% 60 78 0.00% 61 70 0.00% 62 75 0.00% 63 87 0.00% 64 84 0.00% 65 92 0.00% 66 82 0.00% 67 83 0.00% 68 86 0.00% 69 75 0.00% 70 88 0.00% 71 122 0.00% 72 90 0.00% 73 107 0.00% 74 85 0.00% 75 87 0.00% 76 83 0.00% 77 100 0.00% 78 107 0.00% 79 127 0.00% 80 102 0.00% 81 123 0.00% 82 114 0.00% 83 138 0.00% 84 137 0.00% 85 133 0.00% 86 139 0.00% 87 137 0.00% 88 131 0.00% 89 170 0.00% 90 157 0.00% 91 277 0.01% 92 198 0.01% 93 177 0.01% 94 331 0.01% 95 1016 0.03% 96 4738 0.14% 97 14641 0.43% 98 59039 1.74% 99 224361 6.60% 100 743759 21.87% 101 2347269 69.02% 3400841 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=17 prefix-density=0.34 prefix-fanout=2.0 sequence=GCTCCTTTCCAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=220.48 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=22.8 sequence=CCGCCGCCGCCA Started job on | Dec 12 02:09:22 Started mapping on | Dec 12 02:09:22 Finished on | Dec 12 02:09:30 Mapping speed, Million of reads per hour | 1530.38 Number of input reads | 3400841 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3212751 Uniquely mapped reads % | 94.47% Average mapped length | 100.26 Number of splices: Total | 1111182 Number of splices: Annotated (sjdb) | 1054581 Number of splices: GT/AG | 1095964 Number of splices: GC/AG | 13452 Number of splices: AT/AC | 549 Number of splices: Non-canonical | 1217 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.00% Deletion average length | 1.80 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 91918 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 58351 % of reads mapped to too many loci | 1.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.85% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 96172 96172 96172 N_multimapping 91918 91918 91918 N_noFeature 109179 1675810 1604005 N_ambiguous 48557 3765 3056 UnstrandedReadsAssigned:3055015 PositiveStrandReadsAssigned:1533176 NegativeStrandReadsAssigned:1605690 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853468 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853468-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,400,841 reads, 3,142,447 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 SRR21853468.ke.tsv 35125 SRR21853468.se.tsv 88098 total ==> SRR21853468.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 13.1721 8.29765 PNS24247 1044 945 9.40318 5.24648 PNS24249 1928 1829 34.6183 9.9797 PNS24246 1044 945 9.40318 5.24648 PNS24248 1044 945 9.40318 5.24648 PNS24244 1471 1372 0 0 PNS24243 293 194 2 5.43567 KQK14069 1603 1504 778.446 272.901 KQK14071 474 375 62.6816 88.132 ==> SRR21853468.se.tsv <== BRADI_1g14170v3 907 BRADI_1g53295v3 19 BRADI_1g59795v3 35 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 371 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 37 BRADI_1g48960v3 0 SRR21853468 completed mapping pipeline successfully