Starting /dee2/code/volunteer_pipeline.sh SRR21853469 current disk space = 1550321471488 free memory = 1599658804 SRR21853469 SRAfilesize 36b4535834ec4bd3baf58ddc6265e6a1 SRR21853469.sra SRR21853469.sra file validated SRR21853469 is single end SRR21853469 is conventional basespace SRR21853469 read1 length is 95-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 95-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.606 37.0 37.0 37.0 37.0 37.0 2 35.9185 37.0 37.0 37.0 37.0 37.0 3 35.985 37.0 37.0 37.0 37.0 37.0 4 36.0305 37.0 37.0 37.0 37.0 37.0 5 36.054 37.0 37.0 37.0 37.0 37.0 6 36.0655 37.0 37.0 37.0 37.0 37.0 7 35.98 37.0 37.0 37.0 37.0 37.0 8 35.998 37.0 37.0 37.0 37.0 37.0 9 36.035 37.0 37.0 37.0 37.0 37.0 10-11 36.05775 37.0 37.0 37.0 37.0 37.0 12-13 36.13725 37.0 37.0 37.0 37.0 37.0 14-15 36.00075 37.0 37.0 37.0 37.0 37.0 16-17 35.86325 37.0 37.0 37.0 37.0 37.0 18-19 35.949 37.0 37.0 37.0 37.0 37.0 20-21 36.003 37.0 37.0 37.0 37.0 37.0 22-23 35.96025 37.0 37.0 37.0 37.0 37.0 24-25 35.90175 37.0 37.0 37.0 37.0 37.0 26-27 35.809250000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.80825 37.0 37.0 37.0 37.0 37.0 30-31 35.76475 37.0 37.0 37.0 37.0 37.0 32-33 35.7325 37.0 37.0 37.0 37.0 37.0 34-35 35.78125 37.0 37.0 37.0 37.0 37.0 36-37 35.75175 37.0 37.0 37.0 37.0 37.0 38-39 35.803 37.0 37.0 37.0 37.0 37.0 40-41 35.81375 37.0 37.0 37.0 37.0 37.0 42-43 35.71725 37.0 37.0 37.0 37.0 37.0 44-45 35.7545 37.0 37.0 37.0 37.0 37.0 46-47 35.739 37.0 37.0 37.0 37.0 37.0 48-49 35.63075 37.0 37.0 37.0 37.0 37.0 50-51 35.696749999999994 37.0 37.0 37.0 37.0 37.0 52-53 35.65625 37.0 37.0 37.0 37.0 37.0 54-55 35.59025 37.0 37.0 37.0 37.0 37.0 56-57 35.659000000000006 37.0 37.0 37.0 37.0 37.0 58-59 35.70025 37.0 37.0 37.0 37.0 37.0 60-61 35.68625 37.0 37.0 37.0 37.0 37.0 62-63 35.76675 37.0 37.0 37.0 37.0 37.0 64-65 35.65775 37.0 37.0 37.0 37.0 37.0 66-67 35.58775 37.0 37.0 37.0 37.0 37.0 68-69 35.658 37.0 37.0 37.0 37.0 37.0 70-71 35.62125 37.0 37.0 37.0 37.0 37.0 72-73 35.59925 37.0 37.0 37.0 37.0 37.0 74-75 35.52275 37.0 37.0 37.0 37.0 37.0 76-77 35.5415 37.0 37.0 37.0 37.0 37.0 78-79 35.58425 37.0 37.0 37.0 37.0 37.0 80-81 35.54875 37.0 37.0 37.0 37.0 37.0 82-83 35.526250000000005 37.0 37.0 37.0 37.0 37.0 84-85 35.619749999999996 37.0 37.0 37.0 37.0 37.0 86-87 35.486999999999995 37.0 37.0 37.0 37.0 37.0 88-89 35.480500000000006 37.0 37.0 37.0 37.0 37.0 90-91 35.513999999999996 37.0 37.0 37.0 37.0 37.0 92-93 35.5745 37.0 37.0 37.0 37.0 37.0 94-95 35.4945 37.0 37.0 37.0 37.0 37.0 96-97 35.52447294985861 37.0 37.0 37.0 37.0 37.0 98-99 35.41803725274257 37.0 37.0 37.0 37.0 37.0 100-101 35.362533766279995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 3.0 24 4.0 25 13.0 26 12.0 27 14.0 28 20.0 29 42.0 30 65.0 31 68.0 32 132.0 33 171.0 34 237.0 35 459.0 36 2174.0 37 585.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.049999999999997 12.425 17.325 41.199999999999996 2 24.0 19.3 31.15 25.55 3 27.275 22.400000000000002 22.6 27.725 4 26.775 29.225 17.75 26.25 5 29.375 29.75 20.025000000000002 20.849999999999998 6 22.05 34.300000000000004 20.0 23.65 7 20.375 16.925 37.025000000000006 25.674999999999997 8 22.825 21.325 25.5 30.349999999999998 9 21.3 21.55 28.725 28.425 10-11 25.424999999999997 27.6625 20.175 26.737499999999997 12-13 23.95 22.225 25.35 28.475 14-15 24.099999999999998 24.474999999999998 25.1 26.325 16-17 25.5125 23.925 23.8125 26.75 18-19 24.2875 25.1 23.9375 26.674999999999997 20-21 24.762500000000003 24.212500000000002 24.5125 26.5125 22-23 23.9125 25.0625 24.4875 26.5375 24-25 24.375 23.525 24.2625 27.8375 26-27 25.650000000000002 23.575 24.349999999999998 26.424999999999997 28-29 24.65 23.8625 24.275 27.212500000000002 30-31 24.6 24.462500000000002 25.0375 25.900000000000002 32-33 24.587500000000002 25.1875 23.8875 26.337500000000002 34-35 24.4375 24.675 24.587500000000002 26.3 36-37 24.5625 23.775 24.9 26.7625 38-39 25.674999999999997 24.337500000000002 23.325000000000003 26.6625 40-41 25.387500000000003 25.124999999999996 23.25 26.237500000000004 42-43 24.4125 23.65 25.25 26.687499999999996 44-45 25.2 24.1625 24.462500000000002 26.174999999999997 46-47 25.4 24.962500000000002 22.8625 26.775 48-49 25.7 23.625 23.799999999999997 26.875 50-51 25.4 23.8375 24.4 26.3625 52-53 25.387500000000003 24.825 23.150000000000002 26.637499999999996 54-55 26.174999999999997 23.724999999999998 23.825 26.275 56-57 25.087500000000002 25.0375 22.975 26.900000000000002 58-59 24.725 24.224999999999998 24.425 26.625 60-61 25.8625 23.6375 23.9125 26.5875 62-63 25.387500000000003 23.625 24.212500000000002 26.775 64-65 25.5125 24.325 23.175 26.987499999999997 66-67 25.75 24.05 23.4875 26.7125 68-69 25.4625 23.875 24.125 26.5375 70-71 25.2375 23.8125 23.5375 27.4125 72-73 25.7125 24.775 23.525 25.9875 74-75 26.025 24.762500000000003 23.8625 25.35 76-77 25.575 23.4375 24.2 26.787499999999998 78-79 25.6 24.4375 23.7 26.2625 80-81 24.525 24.2 24.7 26.575 82-83 25.7125 23.962500000000002 23.3875 26.937499999999996 84-85 25.637500000000003 23.7375 23.9125 26.7125 86-87 25.5 24.2625 24.349999999999998 25.887500000000003 88-89 27.3125 23.7125 23.225 25.75 90-91 25.650000000000002 23.875 24.5375 25.937500000000004 92-93 25.324999999999996 24.85 23.724999999999998 26.1 94-95 25.7625 23.9 23.549999999999997 26.787499999999998 96-97 25.043804755944933 22.81602002503129 24.84355444305382 27.29662077596996 98-99 25.685975609756095 23.246951219512198 25.01270325203252 26.054369918699187 100-101 26.410096603303206 10.174509192894982 29.401682767217203 34.0137114365846 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.5 5 2.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 1.0 27 1.5 28 2.5 29 3.5 30 5.5 31 8.0 32 15.0 33 22.5 34 20.0 35 24.0 36 35.0 37 45.5 38 57.5 39 81.0 40 111.0 41 128.5 42 133.5 43 148.5 44 157.5 45 166.5 46 172.5 47 170.5 48 174.0 49 150.0 50 141.0 51 149.5 52 133.0 53 117.0 54 117.0 55 102.0 56 93.0 57 91.5 58 85.0 59 88.0 60 84.5 61 80.0 62 82.5 63 81.0 64 73.5 65 59.5 66 51.0 67 55.5 68 66.0 69 78.5 70 71.0 71 53.0 72 37.5 73 37.5 74 37.5 75 25.0 76 19.0 77 16.0 78 12.5 79 9.5 80 6.0 81 2.0 82 2.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 95 1.0 96 8.0 97 21.0 98 68.0 99 264.0 100 858.0 101 2780.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20146222583266 85.125 2 7.365285675602491 13.600000000000001 3 0.3520173300839426 0.975 4 0.08123476848090982 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386571 spots for SRR21853469.sra Written 386571 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra Read 386552 spots for SRR21853469.sra Written 386552 spots for SRR21853469.sra SRR ids: ['SRR21853469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0ljgpgy0 SRR21853469.sra spots: 7731059 blocks: [[1, 386552], [386553, 773104], [773105, 1159656], [1159657, 1546208], [1546209, 1932760], [1932761, 2319312], [2319313, 2705864], [2705865, 3092416], [3092417, 3478968], [3478969, 3865520], [3865521, 4252072], [4252073, 4638624], [4638625, 5025176], [5025177, 5411728], [5411729, 5798280], [5798281, 6184832], [6184833, 6571384], [6571385, 6957936], [6957937, 7344488], [7344489, 7731059]] SRR21853469 file size 2078730 SRR21853469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853469 SRR21853469_1.fastq Input file: SRR21853469_1.fastq trimmed: SRR21853469-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:35:14 2024 >> started Fri Dec 6 15:35:18 2024 >> done (3.933s) 7731059 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 9536 ( 0.12%) empty reads filtered out after trimming by size control 7721518 (99.88%) reads available; of these: 242 ( 0.00%) trimmed reads available after processing 7721276 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 6 0.00% 33 7 0.00% 34 3 0.00% 35 18 0.00% 36 12 0.00% 37 14 0.00% 38 11 0.00% 39 11 0.00% 40 15 0.00% 41 19 0.00% 42 13 0.00% 43 13 0.00% 44 11 0.00% 45 11 0.00% 46 19 0.00% 47 15 0.00% 48 15 0.00% 49 15 0.00% 50 6 0.00% 51 24 0.00% 52 21 0.00% 53 16 0.00% 54 21 0.00% 55 16 0.00% 56 19 0.00% 57 15 0.00% 58 16 0.00% 59 19 0.00% 60 22 0.00% 61 31 0.00% 62 25 0.00% 63 19 0.00% 64 27 0.00% 65 22 0.00% 66 29 0.00% 67 27 0.00% 68 33 0.00% 69 23 0.00% 70 23 0.00% 71 34 0.00% 72 26 0.00% 73 38 0.00% 74 32 0.00% 75 17 0.00% 76 26 0.00% 77 32 0.00% 78 33 0.00% 79 40 0.00% 80 33 0.00% 81 42 0.00% 82 35 0.00% 83 41 0.00% 84 37 0.00% 85 41 0.00% 86 56 0.00% 87 46 0.00% 88 69 0.00% 89 60 0.00% 90 91 0.00% 91 252 0.00% 92 69 0.00% 93 143 0.00% 94 448 0.01% 95 1916 0.02% 96 10295 0.13% 97 34990 0.45% 98 137536 1.78% 99 515582 6.68% 100 1726308 22.36% 101 5292459 68.54% 7721518 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=15 prefix-density=0.53 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=190.32 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=21.9 sequence=GCCGCCGCCGCC Started job on | Dec 06 15:35:35 Started mapping on | Dec 06 15:35:35 Finished on | Dec 06 15:35:47 Mapping speed, Million of reads per hour | 2316.46 Number of input reads | 7721518 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 7326393 Uniquely mapped reads % | 94.88% Average mapped length | 100.33 Number of splices: Total | 2615724 Number of splices: Annotated (sjdb) | 2483916 Number of splices: GT/AG | 2581630 Number of splices: GC/AG | 30905 Number of splices: AT/AC | 1317 Number of splices: Non-canonical | 1872 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 201514 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 131413 % of reads mapped to too many loci | 1.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.57% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 193611 193611 193611 N_multimapping 201514 201514 201514 N_noFeature 245698 3858211 3609575 N_ambiguous 117932 7346 7123 UnstrandedReadsAssigned:6962763 PositiveStrandReadsAssigned:3460836 NegativeStrandReadsAssigned:3709695 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853469 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853469-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,721,518 reads, 7,172,747 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR21853469.ke.tsv 35125 SRR21853469.se.tsv 88098 total ==> SRR21853469.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.65752 0.457088 PNS24247 1044 945 24.1121 5.88938 PNS24249 1928 1829 38.1112 4.80956 PNS24246 1044 945 24.1121 5.88938 PNS24248 1044 945 24.1121 5.88938 PNS24244 1471 1372 30.895 5.19758 PNS24243 293 194 8 9.5182 KQK14069 1603 1504 2034.08 312.166 KQK14071 474 375 140.419 86.4293 ==> SRR21853469.se.tsv <== BRADI_1g14170v3 2299 BRADI_1g53295v3 48 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 890 BRADI_1g74790v3 97 BRADI_1g09890v3 3 BRADI_1g77505v3 110 BRADI_1g48960v3 0 SRR21853469 completed mapping pipeline successfully