Starting /dee2/code/volunteer_pipeline.sh SRR21853470 current disk space = 1550352732160 free memory = 1598294044 SRR21853470 SRAfilesize 102e6f75fb1487b3a7051df0713ac63c SRR21853470.sra SRR21853470.sra file validated SRR21853470 is single end SRR21853470 is conventional basespace SRR21853470 read1 length is 54-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.026 37.0 37.0 37.0 25.0 37.0 2 35.0455 37.0 37.0 37.0 25.0 37.0 3 35.4135 37.0 37.0 37.0 37.0 37.0 4 35.558 37.0 37.0 37.0 37.0 37.0 5 35.635 37.0 37.0 37.0 37.0 37.0 6 35.7715 37.0 37.0 37.0 37.0 37.0 7 35.4155 37.0 37.0 37.0 37.0 37.0 8 35.7795 37.0 37.0 37.0 37.0 37.0 9 35.747 37.0 37.0 37.0 37.0 37.0 10-11 35.91775 37.0 37.0 37.0 37.0 37.0 12-13 35.830749999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.7245 37.0 37.0 37.0 37.0 37.0 16-17 35.785 37.0 37.0 37.0 37.0 37.0 18-19 35.73525 37.0 37.0 37.0 37.0 37.0 20-21 35.69125 37.0 37.0 37.0 37.0 37.0 22-23 35.71925 37.0 37.0 37.0 37.0 37.0 24-25 35.6015 37.0 37.0 37.0 37.0 37.0 26-27 35.589 37.0 37.0 37.0 37.0 37.0 28-29 35.62675 37.0 37.0 37.0 37.0 37.0 30-31 35.53175 37.0 37.0 37.0 37.0 37.0 32-33 35.39825 37.0 37.0 37.0 31.0 37.0 34-35 35.47025 37.0 37.0 37.0 37.0 37.0 36-37 35.51775 37.0 37.0 37.0 37.0 37.0 38-39 35.48825 37.0 37.0 37.0 37.0 37.0 40-41 35.518 37.0 37.0 37.0 37.0 37.0 42-43 35.43925 37.0 37.0 37.0 37.0 37.0 44-45 35.48375 37.0 37.0 37.0 37.0 37.0 46-47 35.407 37.0 37.0 37.0 37.0 37.0 48-49 35.41825 37.0 37.0 37.0 37.0 37.0 50-51 35.326499999999996 37.0 37.0 37.0 37.0 37.0 52-53 35.456 37.0 37.0 37.0 37.0 37.0 54-55 35.45156214053513 37.0 37.0 37.0 37.0 37.0 56-57 35.408664009424065 37.0 37.0 37.0 37.0 37.0 58-59 35.33016508254127 37.0 37.0 37.0 37.0 37.0 60-61 35.39469734867434 37.0 37.0 37.0 37.0 37.0 62-63 35.295897948974485 37.0 37.0 37.0 31.0 37.0 64-65 35.27263631815907 37.0 37.0 37.0 31.0 37.0 66-67 35.25812906453227 37.0 37.0 37.0 25.0 37.0 68-69 35.41470735367684 37.0 37.0 37.0 37.0 37.0 70-71 35.34892446223111 37.0 37.0 37.0 31.0 37.0 72-73 35.3471735867934 37.0 37.0 37.0 37.0 37.0 74-75 35.249374687343675 37.0 37.0 37.0 31.0 37.0 76-77 35.188594297148576 37.0 37.0 37.0 25.0 37.0 78-79 35.26513256628314 37.0 37.0 37.0 31.0 37.0 80-81 35.2456228114057 37.0 37.0 37.0 25.0 37.0 82-83 35.222130579925945 37.0 37.0 37.0 31.0 37.0 84-85 35.19139354515887 37.0 37.0 37.0 25.0 37.0 86-87 35.21941456092069 37.0 37.0 37.0 31.0 37.0 88-89 35.2194145609207 37.0 37.0 37.0 25.0 37.0 90-91 35.18388791593695 37.0 37.0 37.0 25.0 37.0 92-93 35.21621621621621 37.0 37.0 37.0 31.0 37.0 94-95 35.02528467294182 37.0 37.0 37.0 25.0 37.0 96-97 35.085250116900525 37.0 37.0 37.0 25.0 37.0 98-99 35.07892924133674 37.0 37.0 37.0 25.0 37.0 100-101 35.0791709259398 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 5.0 25 12.0 26 8.0 27 20.0 28 42.0 29 53.0 30 78.0 31 122.0 32 150.0 33 210.0 34 264.0 35 638.0 36 2063.0 37 331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.150000000000002 13.3 17.549999999999997 42.0 2 25.5050505050505 19.116161616161616 30.782828282828284 24.595959595959595 3 26.5 22.975 22.775000000000002 27.750000000000004 4 27.800000000000004 28.075 19.45 24.675 5 28.375 29.049999999999997 21.15 21.425 6 21.675 33.775 20.45 24.099999999999998 7 20.025000000000002 16.45 38.2 25.324999999999996 8 22.125 23.325000000000003 23.65 30.9 9 22.0 20.974999999999998 28.675 28.349999999999998 10-11 26.224999999999998 27.500000000000004 19.950000000000003 26.325 12-13 24.887500000000003 21.75 25.874999999999996 27.487499999999997 14-15 23.3375 24.2375 25.525 26.900000000000002 16-17 24.6 24.349999999999998 24.25 26.8 18-19 25.174999999999997 24.4375 24.075 26.3125 20-21 24.637500000000003 24.725 24.5625 26.075 22-23 24.6625 24.175 24.4125 26.75 24-25 23.7375 24.95 24.775 26.5375 26-27 24.875 24.775 24.5625 25.7875 28-29 25.674999999999997 24.375 24.5625 25.387500000000003 30-31 24.775 24.275 24.5125 26.437500000000004 32-33 24.5375 24.9875 23.8625 26.6125 34-35 25.15 24.712500000000002 23.5125 26.625 36-37 25.25 25.0 23.549999999999997 26.200000000000003 38-39 26.5625 24.725 23.925 24.7875 40-41 24.95 25.337500000000002 23.7375 25.974999999999998 42-43 24.9125 25.137500000000003 24.925 25.025 44-45 26.137500000000003 24.1375 23.575 26.150000000000002 46-47 26.1 24.075 23.7 26.125 48-49 24.775 25.337500000000002 22.787499999999998 27.1 50-51 25.3125 24.1875 24.325 26.174999999999997 52-53 25.974999999999998 23.9375 23.0875 27.0 54-55 25.59069883735467 23.8404800600075 23.902987873484186 26.665833229153645 56-57 25.559584844316618 24.546705014380393 23.82143303738902 26.072277103913965 58-59 24.524762381190595 24.949974987493746 23.686843421710854 26.8384192096048 60-61 25.53776888444222 24.112056028014006 24.83741870935468 25.512756378189096 62-63 26.413206603301653 23.536768384192097 24.16208104052026 25.887943971985994 64-65 25.52526263131566 24.437218609304654 24.362181090545274 25.67533766883442 66-67 25.41270635317659 24.074537268634316 24.087043521760883 26.425712856428213 68-69 25.437718859429715 24.574787393696848 23.974487243621812 26.013006503251624 70-71 25.337668834417208 24.61230615307654 23.649324662331164 26.40070035017509 72-73 25.48774387193597 23.649324662331164 24.637318659329665 26.225612806403202 74-75 25.950475237618807 24.224612306153077 23.82441220610305 26.000500250125064 76-77 25.71285642821411 24.574787393696848 23.611805902951478 26.100550275137568 78-79 25.912956478239117 23.78689344672336 24.19959979989995 26.100550275137568 80-81 25.48774387193597 24.424712356178087 23.224112056028016 26.863431715857928 82-83 26.6541588492808 24.102564102564102 23.652282676672918 25.59099437148218 84-85 25.719289467100324 24.218163622717036 24.11808856642482 25.94445834375782 86-87 24.530898173630224 24.580935701776333 23.930447835876908 26.957718288716535 88-89 26.682511883912934 23.34250688016012 24.305729296972732 25.66925193895422 90-91 25.369026770077557 25.243932949712285 23.179884913685264 26.207155366524894 92-93 25.75075075075075 23.8988988988989 23.385885885885884 26.964464464464466 94-95 25.747903367129805 23.882838903492303 24.521216672925274 25.84804105645262 96-97 25.2442996742671 24.780756702580806 24.555249310949637 25.419694312202456 98-99 25.91886048581966 23.04463945059138 24.30370087752766 26.7327991860613 100-101 26.956931782458348 10.40553285130462 30.210625589437285 32.426909776799754 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 6.5 30 8.0 31 6.5 32 13.0 33 18.0 34 22.0 35 28.0 36 39.5 37 58.5 38 68.0 39 72.5 40 100.0 41 130.5 42 146.5 43 156.0 44 158.0 45 161.5 46 166.0 47 177.5 48 171.0 49 159.0 50 149.5 51 137.0 52 134.5 53 119.5 54 108.0 55 101.5 56 98.5 57 95.5 58 94.5 59 101.5 60 88.5 61 81.5 62 83.0 63 77.0 64 88.5 65 78.0 66 56.0 67 59.0 68 55.5 69 45.5 70 39.5 71 39.0 72 44.5 73 43.0 74 33.5 75 20.5 76 14.5 77 13.0 78 9.0 79 9.0 80 8.5 81 4.0 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 0.0 93 1.0 94 1.0 95 0.0 96 6.0 97 18.0 98 77.0 99 279.0 100 866.0 101 2748.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.76166355638496 87.925 2 5.838443081844842 10.95 3 0.39989336177019463 1.125 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679833 spots for SRR21853470.sra Written 679833 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra Read 679827 spots for SRR21853470.sra Written 679827 spots for SRR21853470.sra SRR ids: ['SRR21853470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cu7yi0en SRR21853470.sra spots: 13596546 blocks: [[1, 679827], [679828, 1359654], [1359655, 2039481], [2039482, 2719308], [2719309, 3399135], [3399136, 4078962], [4078963, 4758789], [4758790, 5438616], [5438617, 6118443], [6118444, 6798270], [6798271, 7478097], [7478098, 8157924], [8157925, 8837751], [8837752, 9517578], [9517579, 10197405], [10197406, 10877232], [10877233, 11557059], [11557060, 12236886], [12236887, 12916713], [12916714, 13596546]] SRR21853470 file size 3659828 SRR21853470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853470 SRR21853470_1.fastq Input file: SRR21853470_1.fastq trimmed: SRR21853470-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:35:50 2024 >> started Fri Dec 6 15:35:58 2024 >> done (7.657s) 13596546 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 30106 ( 0.22%) empty reads filtered out after trimming by size control 13566426 (99.78%) reads available; of these: 336 ( 0.00%) trimmed reads available after processing 13566090 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 0 0.00% 24 5 0.00% 25 1 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 4 0.00% 32 5 0.00% 33 2 0.00% 34 6 0.00% 35 55 0.00% 36 53 0.00% 37 55 0.00% 38 86 0.00% 39 62 0.00% 40 69 0.00% 41 63 0.00% 42 77 0.00% 43 59 0.00% 44 73 0.00% 45 83 0.00% 46 78 0.00% 47 78 0.00% 48 65 0.00% 49 80 0.00% 50 65 0.00% 51 82 0.00% 52 95 0.00% 53 87 0.00% 54 74 0.00% 55 82 0.00% 56 94 0.00% 57 95 0.00% 58 92 0.00% 59 120 0.00% 60 103 0.00% 61 110 0.00% 62 99 0.00% 63 138 0.00% 64 115 0.00% 65 133 0.00% 66 138 0.00% 67 119 0.00% 68 128 0.00% 69 130 0.00% 70 120 0.00% 71 99 0.00% 72 121 0.00% 73 116 0.00% 74 114 0.00% 75 131 0.00% 76 147 0.00% 77 147 0.00% 78 138 0.00% 79 149 0.00% 80 170 0.00% 81 156 0.00% 82 145 0.00% 83 163 0.00% 84 168 0.00% 85 156 0.00% 86 175 0.00% 87 169 0.00% 88 184 0.00% 89 238 0.00% 90 266 0.00% 91 540 0.00% 92 254 0.00% 93 346 0.00% 94 853 0.01% 95 3328 0.02% 96 18879 0.14% 97 61390 0.45% 98 243340 1.79% 99 906462 6.68% 100 3039895 22.41% 101 9284679 68.44% 13566426 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=13 prefix-density=0.54 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=18 fanout-score=189.74 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=23.7 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:36:15 Started mapping on | Dec 06 15:36:15 Finished on | Dec 06 15:36:32 Mapping speed, Million of reads per hour | 2872.89 Number of input reads | 13566426 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12851747 Uniquely mapped reads % | 94.73% Average mapped length | 100.29 Number of splices: Total | 4617615 Number of splices: Annotated (sjdb) | 4385530 Number of splices: GT/AG | 4556427 Number of splices: GC/AG | 54865 Number of splices: AT/AC | 2311 Number of splices: Non-canonical | 4012 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354911 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 222403 % of reads mapped to too many loci | 1.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 359768 359768 359768 N_multimapping 354911 354911 354911 N_noFeature 430863 6743500 6356665 N_ambiguous 206709 12892 12816 UnstrandedReadsAssigned:12214175 PositiveStrandReadsAssigned:6095355 NegativeStrandReadsAssigned:6482266 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853470 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853470-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,566,426 reads, 12,568,502 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52973 SRR21853470.ke.tsv 35125 SRR21853470.se.tsv 88098 total ==> SRR21853470.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 17.2343 2.69496 PNS24247 1044 945 45.2734 6.27041 PNS24249 1928 1829 80.9213 5.79074 PNS24246 1044 945 45.2734 6.27041 PNS24248 1044 945 45.2734 6.27041 PNS24244 1471 1372 22.0242 2.10103 PNS24243 293 194 15 10.1199 KQK14069 1603 1504 3615.27 314.614 KQK14071 474 375 302.78 105.677 ==> SRR21853470.se.tsv <== BRADI_1g14170v3 4316 BRADI_1g53295v3 72 BRADI_1g59795v3 182 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 1496 BRADI_1g74790v3 154 BRADI_1g09890v3 9 BRADI_1g77505v3 201 BRADI_1g48960v3 0 SRR21853470 completed mapping pipeline successfully