Starting /dee2/code/volunteer_pipeline.sh SRR21853471 current disk space = 1550298271744 free memory = 1597566296 SRR21853471 SRAfilesize 748ba7883ebe1c2826610e9e812c874c SRR21853471.sra SRR21853471.sra file validated SRR21853471 is single end SRR21853471 is conventional basespace SRR21853471 read1 length is 67-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 67-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.129 37.0 37.0 37.0 25.0 37.0 2 35.035 37.0 37.0 37.0 37.0 37.0 3 35.765 37.0 37.0 37.0 37.0 37.0 4 35.9315 37.0 37.0 37.0 37.0 37.0 5 35.9545 37.0 37.0 37.0 37.0 37.0 6 35.8565 37.0 37.0 37.0 37.0 37.0 7 35.6455 37.0 37.0 37.0 37.0 37.0 8 35.8755 37.0 37.0 37.0 37.0 37.0 9 35.9125 37.0 37.0 37.0 37.0 37.0 10-11 35.935 37.0 37.0 37.0 37.0 37.0 12-13 35.9455 37.0 37.0 37.0 37.0 37.0 14-15 35.89925 37.0 37.0 37.0 37.0 37.0 16-17 35.96425 37.0 37.0 37.0 37.0 37.0 18-19 35.837 37.0 37.0 37.0 37.0 37.0 20-21 35.9535 37.0 37.0 37.0 37.0 37.0 22-23 35.900999999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.796499999999995 37.0 37.0 37.0 37.0 37.0 26-27 35.795500000000004 37.0 37.0 37.0 37.0 37.0 28-29 35.683 37.0 37.0 37.0 37.0 37.0 30-31 35.722750000000005 37.0 37.0 37.0 37.0 37.0 32-33 35.745 37.0 37.0 37.0 37.0 37.0 34-35 35.74925 37.0 37.0 37.0 37.0 37.0 36-37 35.72175 37.0 37.0 37.0 37.0 37.0 38-39 35.6735 37.0 37.0 37.0 37.0 37.0 40-41 35.5985 37.0 37.0 37.0 37.0 37.0 42-43 35.659 37.0 37.0 37.0 37.0 37.0 44-45 35.5685 37.0 37.0 37.0 37.0 37.0 46-47 35.526250000000005 37.0 37.0 37.0 37.0 37.0 48-49 35.463499999999996 37.0 37.0 37.0 37.0 37.0 50-51 35.539249999999996 37.0 37.0 37.0 37.0 37.0 52-53 35.564750000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.6045 37.0 37.0 37.0 37.0 37.0 56-57 35.59125 37.0 37.0 37.0 37.0 37.0 58-59 35.563 37.0 37.0 37.0 37.0 37.0 60-61 35.6285 37.0 37.0 37.0 37.0 37.0 62-63 35.542 37.0 37.0 37.0 37.0 37.0 64-65 35.46325 37.0 37.0 37.0 37.0 37.0 66-67 35.41675 37.0 37.0 37.0 37.0 37.0 68-69 35.38519259629815 37.0 37.0 37.0 37.0 37.0 70-71 35.39019509754877 37.0 37.0 37.0 37.0 37.0 72-73 35.38744372186093 37.0 37.0 37.0 37.0 37.0 74-75 35.375937968984495 37.0 37.0 37.0 37.0 37.0 76-77 35.3271635817909 37.0 37.0 37.0 37.0 37.0 78-79 35.351175587793904 37.0 37.0 37.0 37.0 37.0 80-81 35.48849424712356 37.0 37.0 37.0 37.0 37.0 82-83 35.340170085042516 37.0 37.0 37.0 37.0 37.0 84-85 35.44647323661831 37.0 37.0 37.0 37.0 37.0 86-87 35.3744372186093 37.0 37.0 37.0 31.0 37.0 88-89 35.35392696348174 37.0 37.0 37.0 37.0 37.0 90-91 35.28414207103552 37.0 37.0 37.0 37.0 37.0 92-93 35.399699849924964 37.0 37.0 37.0 37.0 37.0 94-95 35.208354177088545 37.0 37.0 37.0 25.0 37.0 96-97 35.23227019321284 37.0 37.0 37.0 31.0 37.0 98-99 35.349560925907014 37.0 37.0 37.0 37.0 37.0 100-101 35.22316555284509 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 3.0 24 2.0 25 5.0 26 19.0 27 21.0 28 46.0 29 54.0 30 64.0 31 102.0 32 116.0 33 165.0 34 270.0 35 498.0 36 2140.0 37 490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.525 13.075000000000001 18.925 39.475 2 26.71890798786653 19.337714863498483 30.257836198179977 23.685540950455007 3 27.150000000000002 24.525 22.95 25.374999999999996 4 26.450000000000003 30.4 18.925 24.224999999999998 5 29.475 29.075 19.825 21.625 6 22.725 31.525 21.349999999999998 24.4 7 18.9 16.7 40.65 23.75 8 24.575 19.900000000000002 24.625 30.9 9 23.3 19.175 28.675 28.849999999999998 10-11 26.75 27.787499999999998 19.2625 26.200000000000003 12-13 23.525 21.6875 26.924999999999997 27.8625 14-15 24.087500000000002 23.5375 25.7375 26.637499999999996 16-17 25.7 23.575 24.3875 26.337500000000002 18-19 24.587500000000002 24.65 24.5 26.2625 20-21 25.124999999999996 24.212500000000002 24.55 26.1125 22-23 26.424999999999997 24.762500000000003 23.0 25.8125 24-25 24.099999999999998 24.7875 25.0375 26.075 26-27 24.5625 25.124999999999996 23.45 26.8625 28-29 24.125 24.5 25.5375 25.837500000000002 30-31 25.137500000000003 25.362499999999997 24.1625 25.337500000000002 32-33 23.8375 25.8125 24.675 25.674999999999997 34-35 24.837500000000002 24.9125 24.8125 25.4375 36-37 25.424999999999997 23.7125 25.3125 25.55 38-39 25.650000000000002 24.825 23.275000000000002 26.25 40-41 26.0 25.825 22.4375 25.7375 42-43 24.7875 25.224999999999998 24.75 25.2375 44-45 26.0125 24.9875 23.875 25.124999999999996 46-47 25.05 24.6625 24.4875 25.8 48-49 25.174999999999997 24.4375 24.5625 25.825 50-51 25.75 24.7875 23.825 25.637500000000003 52-53 25.687500000000004 25.2375 23.1375 25.937500000000004 54-55 25.2125 24.837500000000002 24.325 25.624999999999996 56-57 25.362499999999997 24.5125 24.1875 25.937500000000004 58-59 25.374999999999996 24.1625 24.0625 26.400000000000002 60-61 25.4625 23.6875 25.074999999999996 25.775 62-63 25.2625 25.0625 24.837500000000002 24.837500000000002 64-65 24.4875 24.4125 24.575 26.525 66-67 25.05 24.337500000000002 24.887500000000003 25.724999999999998 68-69 25.437718859429715 24.474737368684345 24.16208104052026 25.925462731365684 70-71 25.512756378189096 23.936968484242122 23.736868434217108 26.813406703351678 72-73 25.65032516258129 24.299649824912457 24.312156078039017 25.737868934467233 74-75 26.125562781390695 24.187093546773387 24.212106053026513 25.475237618809405 76-77 25.46273136568284 24.474737368684345 25.125062531265634 24.937468734367183 78-79 25.63781890945473 25.200100050025014 23.43671835917959 25.72536268134067 80-81 25.46273136568284 24.037018509254626 23.686843421710854 26.813406703351678 82-83 26.038019009504755 24.399699849924964 23.274137068534266 26.28814407203602 84-85 25.662831415707853 24.16208104052026 24.362181090545274 25.812906453226613 86-87 25.962981490745374 23.524262131065534 24.79989994997499 25.71285642821411 88-89 26.013006503251624 24.462231115557778 24.23711855927964 25.287643821910955 90-91 25.475237618809405 24.349674837418707 24.562281140570285 25.6128064032016 92-93 25.86293146573287 23.461730865432717 24.69984992496248 25.975487743871934 94-95 26.500750375187593 24.299649824912457 24.099549774887443 25.100050025012504 96-97 23.69211514392991 24.96871088861076 24.180225281602002 27.15894868585732 98-99 26.23241667722722 23.78659232036497 23.913318970979596 26.067672031428206 100-101 27.776049766718508 9.922239502332815 29.84447900466563 32.45723172628305 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.5 3 1.5 4 1.5 5 1.0 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 1.5 27 1.0 28 1.0 29 4.0 30 6.5 31 10.5 32 14.0 33 19.5 34 29.5 35 31.5 36 33.0 37 43.0 38 61.0 39 86.5 40 103.5 41 115.0 42 128.0 43 136.0 44 159.0 45 186.5 46 197.5 47 193.5 48 174.5 49 162.5 50 154.5 51 136.0 52 129.5 53 129.0 54 118.0 55 109.5 56 100.0 57 86.0 58 87.5 59 92.5 60 75.0 61 69.5 62 80.0 63 73.0 64 51.5 65 58.0 66 75.5 67 63.5 68 57.0 69 63.0 70 55.0 71 45.0 72 43.0 73 36.5 74 28.0 75 18.5 76 13.0 77 17.5 78 13.5 79 3.5 80 3.0 81 2.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0999999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 67 2.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 6.0 97 11.0 98 71.0 99 234.0 100 922.0 101 2754.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.85714285714286 86.125 2 6.711590296495958 12.45 3 0.37735849056603776 1.05 4 0.0 0.0 5 0.0 0.0 6 0.026954177897574125 0.15 7 0.0 0.0 8 0.0 0.0 9 0.026954177897574125 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 13 (97% over 38bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra Read 908748 spots for SRR21853471.sra Written 908748 spots for SRR21853471.sra SRR ids: ['SRR21853471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zsqkut4 SRR21853471.sra spots: 18174960 blocks: [[1, 908748], [908749, 1817496], [1817497, 2726244], [2726245, 3634992], [3634993, 4543740], [4543741, 5452488], [5452489, 6361236], [6361237, 7269984], [7269985, 8178732], [8178733, 9087480], [9087481, 9996228], [9996229, 10904976], [10904977, 11813724], [11813725, 12722472], [12722473, 13631220], [13631221, 14539968], [14539969, 15448716], [15448717, 16357464], [16357465, 17266212], [17266213, 18174960]] SRR21853471 file size 4895657 SRR21853471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853471 SRR21853471_1.fastq Input file: SRR21853471_1.fastq trimmed: SRR21853471-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:38:33 2024 >> started Fri Dec 6 15:38:42 2024 >> done (9.013s) 18174960 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 23848 ( 0.13%) empty reads filtered out after trimming by size control 18151102 (99.87%) reads available; of these: 441 ( 0.00%) trimmed reads available after processing 18150661 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 6 0.00% 25 5 0.00% 26 1 0.00% 27 8 0.00% 28 6 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 6 0.00% 33 7 0.00% 34 5 0.00% 35 82 0.00% 36 89 0.00% 37 96 0.00% 38 113 0.00% 39 90 0.00% 40 93 0.00% 41 87 0.00% 42 89 0.00% 43 94 0.00% 44 108 0.00% 45 105 0.00% 46 102 0.00% 47 106 0.00% 48 113 0.00% 49 119 0.00% 50 137 0.00% 51 117 0.00% 52 121 0.00% 53 134 0.00% 54 159 0.00% 55 132 0.00% 56 127 0.00% 57 153 0.00% 58 166 0.00% 59 140 0.00% 60 171 0.00% 61 152 0.00% 62 146 0.00% 63 166 0.00% 64 175 0.00% 65 168 0.00% 66 168 0.00% 67 165 0.00% 68 181 0.00% 69 159 0.00% 70 177 0.00% 71 186 0.00% 72 191 0.00% 73 195 0.00% 74 220 0.00% 75 171 0.00% 76 236 0.00% 77 225 0.00% 78 226 0.00% 79 262 0.00% 80 264 0.00% 81 257 0.00% 82 262 0.00% 83 290 0.00% 84 313 0.00% 85 300 0.00% 86 315 0.00% 87 330 0.00% 88 351 0.00% 89 413 0.00% 90 519 0.00% 91 1131 0.01% 92 479 0.00% 93 607 0.00% 94 1217 0.01% 95 4348 0.02% 96 24396 0.13% 97 84523 0.47% 98 329283 1.81% 99 1216791 6.70% 100 4113092 22.66% 101 12364941 68.12% 18151102 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=321.79 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=24.9 sequence=CGCCGCCGCCGG Started job on | Dec 06 15:38:59 Started mapping on | Dec 06 15:38:59 Finished on | Dec 06 15:39:27 Mapping speed, Million of reads per hour | 2333.71 Number of input reads | 18151102 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 16064735 Uniquely mapped reads % | 88.51% Average mapped length | 100.21 Number of splices: Total | 5602501 Number of splices: Annotated (sjdb) | 5290121 Number of splices: GT/AG | 5526700 Number of splices: GC/AG | 61322 Number of splices: AT/AC | 3120 Number of splices: Non-canonical | 11359 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 655754 % of reads mapped to multiple loci | 3.61% Number of reads mapped to too many loci | 924659 % of reads mapped to too many loci | 5.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1430613 1430613 1430613 N_multimapping 655754 655754 655754 N_noFeature 741759 8278502 8322093 N_ambiguous 235769 14760 16632 UnstrandedReadsAssigned:15087207 PositiveStrandReadsAssigned:7771473 NegativeStrandReadsAssigned:7726010 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853471 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853471-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,151,102 reads, 15,659,586 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR21853471.ke.tsv 35125 SRR21853471.se.tsv 88098 total ==> SRR21853471.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 2.66826 0.351227 PNS24247 1044 945 49.9286 5.82107 PNS24249 1928 1829 203.654 12.2678 PNS24246 1044 945 49.9286 5.82107 PNS24248 1044 945 49.9286 5.82107 PNS24244 1471 1372 41.8917 3.36402 PNS24243 293 194 8 4.54332 KQK14069 1603 1504 5081.16 372.22 KQK14071 474 375 583.093 171.314 ==> SRR21853471.se.tsv <== BRADI_1g14170v3 6044 BRADI_1g53295v3 134 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 226 BRADI_1g74790v3 279 BRADI_1g09890v3 1 BRADI_1g77505v3 193 BRADI_1g48960v3 1 SRR21853471 completed mapping pipeline successfully