Starting /dee2/code/volunteer_pipeline.sh SRR21853472 current disk space = 1550371082240 free memory = 1598480512 SRR21853472 SRAfilesize 11d76cd09a46565ebf37cd6bcb845ba1 SRR21853472.sra SRR21853472.sra file validated SRR21853472 is single end SRR21853472 is conventional basespace SRR21853472 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.018 37.0 37.0 37.0 25.0 37.0 2 34.8465 37.0 37.0 37.0 25.0 37.0 3 35.39575 37.0 37.0 37.0 37.0 37.0 4 35.5355 37.0 37.0 37.0 37.0 37.0 5 35.708 37.0 37.0 37.0 37.0 37.0 6 35.676 37.0 37.0 37.0 37.0 37.0 7 35.5925 37.0 37.0 37.0 37.0 37.0 8 35.757 37.0 37.0 37.0 37.0 37.0 9 35.645 37.0 37.0 37.0 37.0 37.0 10-11 35.79175 37.0 37.0 37.0 37.0 37.0 12-13 35.66225 37.0 37.0 37.0 37.0 37.0 14-15 35.73225 37.0 37.0 37.0 37.0 37.0 16-17 35.66525 37.0 37.0 37.0 37.0 37.0 18-19 35.738 37.0 37.0 37.0 37.0 37.0 20-21 35.707499999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.6395 37.0 37.0 37.0 37.0 37.0 24-25 35.666250000000005 37.0 37.0 37.0 37.0 37.0 26-27 35.521249999999995 37.0 37.0 37.0 37.0 37.0 28-29 35.474000000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.397000000000006 37.0 37.0 37.0 37.0 37.0 32-33 35.4945 37.0 37.0 37.0 37.0 37.0 34-35 35.411249999999995 37.0 37.0 37.0 37.0 37.0 36-37 35.485 37.0 37.0 37.0 37.0 37.0 38-39 35.3515 37.0 37.0 37.0 37.0 37.0 40-41 35.4975 37.0 37.0 37.0 37.0 37.0 42-43 35.48525 37.0 37.0 37.0 37.0 37.0 44-45 35.23775 37.0 37.0 37.0 31.0 37.0 46-47 35.42125 37.0 37.0 37.0 37.0 37.0 48-49 35.4225 37.0 37.0 37.0 37.0 37.0 50-51 35.283 37.0 37.0 37.0 31.0 37.0 52-53 35.259 37.0 37.0 37.0 31.0 37.0 54-55 35.3905 37.0 37.0 37.0 37.0 37.0 56-57 35.390249999999995 37.0 37.0 37.0 37.0 37.0 58-59 35.389250000000004 37.0 37.0 37.0 31.0 37.0 60-61 35.44025 37.0 37.0 37.0 37.0 37.0 62-63 35.3465 37.0 37.0 37.0 37.0 37.0 64-65 35.27175 37.0 37.0 37.0 31.0 37.0 66-67 35.300250000000005 37.0 37.0 37.0 37.0 37.0 68-69 35.25775 37.0 37.0 37.0 31.0 37.0 70-71 35.113263440860216 37.0 37.0 37.0 25.0 37.0 72-73 35.33508377094273 37.0 37.0 37.0 37.0 37.0 74-75 35.22930732683171 37.0 37.0 37.0 31.0 37.0 76-77 35.199799949987494 37.0 37.0 37.0 25.0 37.0 78-79 35.24681170292573 37.0 37.0 37.0 31.0 37.0 80-81 35.14228557139285 37.0 37.0 37.0 25.0 37.0 82-83 35.09202300575144 37.0 37.0 37.0 25.0 37.0 84-85 35.10302575643911 37.0 37.0 37.0 25.0 37.0 86-87 35.14203550887722 37.0 37.0 37.0 25.0 37.0 88-89 35.17854463615904 37.0 37.0 37.0 25.0 37.0 90-91 35.16679169792448 37.0 37.0 37.0 25.0 37.0 92-93 35.109277319329834 37.0 37.0 37.0 25.0 37.0 94-95 35.09177294323581 37.0 37.0 37.0 25.0 37.0 96-97 35.12531982519916 37.0 37.0 37.0 25.0 37.0 98-99 35.10935698190575 37.0 37.0 37.0 25.0 37.0 100-101 34.99580744897647 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 4.0 24 1.0 25 10.0 26 12.0 27 34.0 28 40.0 29 65.0 30 96.0 31 106.0 32 133.0 33 218.0 34 296.0 35 585.0 36 2050.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.775000000000002 13.350000000000001 18.7 39.175 2 25.808897876643073 19.464105156723964 31.72396359959555 23.00303336703741 3 26.006501625406354 23.980995248812203 24.681170292573142 25.331332833208304 4 25.650000000000002 29.325000000000003 19.650000000000002 25.374999999999996 5 27.575 31.85 21.2 19.375 6 21.625 32.475 22.125 23.775 7 20.200000000000003 15.925 40.025 23.849999999999998 8 22.625 23.1 24.425 29.849999999999998 9 21.4 21.8 28.9 27.900000000000002 10-11 26.174999999999997 27.462500000000002 20.7 25.662499999999998 12-13 22.7375 22.650000000000002 27.987499999999997 26.625 14-15 23.0375 24.4 26.187500000000004 26.375 16-17 24.825 24.15 24.725 26.3 18-19 24.7 24.9375 24.825 25.5375 20-21 24.7875 24.9375 24.099999999999998 26.174999999999997 22-23 25.0125 24.8 24.925 25.2625 24-25 24.075 25.45 24.762500000000003 25.7125 26-27 24.474999999999998 25.162499999999998 24.337500000000002 26.025 28-29 24.75 25.0 24.762500000000003 25.4875 30-31 24.349999999999998 25.15 24.6125 25.887500000000003 32-33 24.2875 25.137500000000003 25.424999999999997 25.15 34-35 23.5875 25.4375 24.775 26.200000000000003 36-37 24.2375 25.474999999999998 25.2 25.087500000000002 38-39 24.3 25.95 24.2875 25.4625 40-41 24.8125 25.05 24.4875 25.650000000000002 42-43 24.05 25.5625 24.9 25.4875 44-45 25.074999999999996 24.45 25.174999999999997 25.3 46-47 25.025 25.1875 24.65 25.137500000000003 48-49 23.95 25.687500000000004 24.825 25.5375 50-51 24.425 25.025 24.0 26.55 52-53 24.925 25.112499999999997 25.074999999999996 24.887500000000003 54-55 24.1125 25.5375 24.875 25.474999999999998 56-57 25.2375 24.962500000000002 25.025 24.775 58-59 24.962500000000002 25.85 23.5875 25.6 60-61 24.349999999999998 25.025 24.474999999999998 26.150000000000002 62-63 25.587500000000002 24.962500000000002 25.124999999999996 24.325 64-65 25.0 24.9375 24.45 25.6125 66-67 24.224999999999998 25.650000000000002 23.799999999999997 26.325 68-69 24.525 25.825 24.587500000000002 25.0625 70-71 24.753094136767096 25.278159769971246 24.90311288911114 25.065633204150515 72-73 24.50612653163291 24.381095273818453 24.93123280820205 26.18154538634659 74-75 24.20605151287822 25.343835958989747 24.656164041010253 25.79394848712178 76-77 24.968742185546386 25.256314078519633 24.718679669917478 25.056264066016503 78-79 25.018754688672168 25.943985996499126 23.793448362090523 25.243810952738183 80-81 25.131282820705174 24.668667166791696 24.568642160540136 25.63140785196299 82-83 25.18129532383096 25.456364091022753 24.06851712928232 25.29382345586397 84-85 24.706176544136035 24.643660915228807 24.518629657414355 26.131532883220803 86-87 24.131032758189548 25.081270317579396 25.568892223055762 25.218804701175294 88-89 24.85621405351338 25.55638909727432 24.593648412103025 24.99374843710928 90-91 24.50612653163291 24.69367341835459 24.74368592148037 26.056514128532132 92-93 26.131532883220803 24.168542135533883 24.306076519129782 25.393848462115532 94-95 25.081270317579396 23.99349837459365 25.406351587896975 25.51887971992998 96-97 23.908419867383962 25.472288252220693 25.00938321030902 25.609908670086323 98-99 24.654056112733276 24.374761965215182 24.679446489780375 26.291735432271167 100-101 26.47798742138365 11.320754716981133 29.68553459119497 32.51572327044025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 4.0 28 6.0 29 5.0 30 8.5 31 14.5 32 16.5 33 20.0 34 23.5 35 34.5 36 44.5 37 67.0 38 79.5 39 89.5 40 113.5 41 125.5 42 154.0 43 184.0 44 187.5 45 192.0 46 189.5 47 175.0 48 171.0 49 177.5 50 172.0 51 146.5 52 132.0 53 118.0 54 102.5 55 95.5 56 99.5 57 87.5 58 76.0 59 78.5 60 71.5 61 59.0 62 58.5 63 70.0 64 59.5 65 55.0 66 55.0 67 47.0 68 48.0 69 46.0 70 39.0 71 38.0 72 36.5 73 30.0 74 27.0 75 17.5 76 13.0 77 13.0 78 8.5 79 6.0 80 3.5 81 2.5 82 2.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0999999999999999 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 5.0 97 19.0 98 73.0 99 259.0 100 926.0 101 2717.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.59316604378003 87.64999999999999 2 6.03310197544047 11.3 3 0.37373198077949815 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678272 spots for SRR21853472.sra Written 678272 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra Read 678263 spots for SRR21853472.sra Written 678263 spots for SRR21853472.sra SRR ids: ['SRR21853472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1q1wsbe1 SRR21853472.sra spots: 13565269 blocks: [[1, 678263], [678264, 1356526], [1356527, 2034789], [2034790, 2713052], [2713053, 3391315], [3391316, 4069578], [4069579, 4747841], [4747842, 5426104], [5426105, 6104367], [6104368, 6782630], [6782631, 7460893], [7460894, 8139156], [8139157, 8817419], [8817420, 9495682], [9495683, 10173945], [10173946, 10852208], [10852209, 11530471], [11530472, 12208734], [12208735, 12886997], [12886998, 13565269]] SRR21853472 file size 3651107 SRR21853472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853472 SRR21853472_1.fastq Input file: SRR21853472_1.fastq trimmed: SRR21853472-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:39:17 2024 >> started Fri Dec 6 15:39:24 2024 >> done (6.979s) 13565269 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 20945 ( 0.15%) empty reads filtered out after trimming by size control 13544318 (99.85%) reads available; of these: 303 ( 0.00%) trimmed reads available after processing 13544015 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 5 0.00% 25 2 0.00% 26 1 0.00% 27 5 0.00% 28 4 0.00% 29 6 0.00% 30 2 0.00% 31 1 0.00% 32 3 0.00% 33 4 0.00% 34 2 0.00% 35 39 0.00% 36 58 0.00% 37 51 0.00% 38 53 0.00% 39 48 0.00% 40 66 0.00% 41 55 0.00% 42 50 0.00% 43 42 0.00% 44 58 0.00% 45 55 0.00% 46 66 0.00% 47 63 0.00% 48 71 0.00% 49 54 0.00% 50 72 0.00% 51 79 0.00% 52 73 0.00% 53 72 0.00% 54 88 0.00% 55 69 0.00% 56 77 0.00% 57 80 0.00% 58 71 0.00% 59 108 0.00% 60 86 0.00% 61 85 0.00% 62 87 0.00% 63 124 0.00% 64 88 0.00% 65 103 0.00% 66 106 0.00% 67 95 0.00% 68 109 0.00% 69 95 0.00% 70 114 0.00% 71 112 0.00% 72 113 0.00% 73 105 0.00% 74 109 0.00% 75 113 0.00% 76 156 0.00% 77 123 0.00% 78 135 0.00% 79 147 0.00% 80 125 0.00% 81 142 0.00% 82 113 0.00% 83 148 0.00% 84 132 0.00% 85 155 0.00% 86 139 0.00% 87 173 0.00% 88 194 0.00% 89 200 0.00% 90 283 0.00% 91 545 0.00% 92 241 0.00% 93 340 0.00% 94 789 0.01% 95 3186 0.02% 96 18735 0.14% 97 64995 0.48% 98 254278 1.88% 99 916209 6.76% 100 3145389 23.22% 101 9133942 67.44% 13544318 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=12 prefix-density=0.40 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=172.57 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=22.2 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:39:38 Started mapping on | Dec 06 15:39:38 Finished on | Dec 06 15:40:00 Mapping speed, Million of reads per hour | 2216.34 Number of input reads | 13544318 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 12897460 Uniquely mapped reads % | 95.22% Average mapped length | 100.26 Number of splices: Total | 4845594 Number of splices: Annotated (sjdb) | 4606573 Number of splices: GT/AG | 4780707 Number of splices: GC/AG | 57963 Number of splices: AT/AC | 2776 Number of splices: Non-canonical | 4148 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324565 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 182747 % of reads mapped to too many loci | 1.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.82% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 322293 322293 322293 N_multimapping 324565 324565 324565 N_noFeature 512937 6616215 6617972 N_ambiguous 200145 12345 13049 UnstrandedReadsAssigned:12184378 PositiveStrandReadsAssigned:6268900 NegativeStrandReadsAssigned:6266439 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853472 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853472-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,544,318 reads, 12,540,815 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR21853472.ke.tsv 35125 SRR21853472.se.tsv 88098 total ==> SRR21853472.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 31.0804 5.16993 PNS24247 1044 945 29.8373 4.39594 PNS24249 1928 1829 72.209 5.49669 PNS24246 1044 945 29.8373 4.39594 PNS24248 1044 945 29.8373 4.39594 PNS24244 1471 1372 27.1986 2.76004 PNS24243 293 194 16 11.4826 KQK14069 1603 1504 2466.99 228.372 KQK14071 474 375 343.336 127.471 ==> SRR21853472.se.tsv <== BRADI_1g14170v3 3053 BRADI_1g53295v3 101 BRADI_1g59795v3 176 BRADI_1g07683v3 0 BRADI_1g00485v3 66 BRADI_1g20270v3 1491 BRADI_1g74790v3 121 BRADI_1g09890v3 2 BRADI_1g77505v3 157 BRADI_1g48960v3 0 SRR21853472 completed mapping pipeline successfully