Starting /dee2/code/volunteer_pipeline.sh SRR21853473 current disk space = 1550405537792 free memory = 1378000556 SRR21853473 SRAfilesize 46f074cc6de72abfde73258a1265680d SRR21853473.sra SRR21853473.sra file validated SRR21853473 is single end SRR21853473 is conventional basespace SRR21853473 read1 length is 93-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.337 32.0 32.0 32.0 32.0 32.0 2 31.45525 32.0 32.0 32.0 32.0 32.0 3 31.535 32.0 32.0 32.0 32.0 32.0 4 31.59675 32.0 32.0 32.0 32.0 32.0 5 31.6245 32.0 32.0 32.0 32.0 32.0 6 35.08075 36.0 36.0 36.0 36.0 36.0 7 35.29625 36.0 36.0 36.0 36.0 36.0 8 35.1405 36.0 36.0 36.0 36.0 36.0 9 35.0635 36.0 36.0 36.0 36.0 36.0 10-11 35.190749999999994 36.0 36.0 36.0 36.0 36.0 12-13 35.247625 36.0 36.0 36.0 36.0 36.0 14-15 35.19625 36.0 36.0 36.0 36.0 36.0 16-17 35.143125 36.0 36.0 36.0 36.0 36.0 18-19 35.104875 36.0 36.0 36.0 36.0 36.0 20-21 35.130375 36.0 36.0 36.0 36.0 36.0 22-23 35.103875 36.0 36.0 36.0 36.0 36.0 24-25 35.02075 36.0 36.0 36.0 36.0 36.0 26-27 35.022625 36.0 36.0 36.0 36.0 36.0 28-29 35.041875000000005 36.0 36.0 36.0 36.0 36.0 30-31 35.012625 36.0 36.0 36.0 36.0 36.0 32-33 34.881 36.0 36.0 36.0 36.0 36.0 34-35 34.978625 36.0 36.0 36.0 36.0 36.0 36-37 34.8445 36.0 36.0 36.0 34.0 36.0 38-39 34.823625 36.0 36.0 36.0 36.0 36.0 40-41 34.796 36.0 36.0 36.0 36.0 36.0 42-43 34.860749999999996 36.0 36.0 36.0 36.0 36.0 44-45 34.86475 36.0 36.0 36.0 36.0 36.0 46-47 34.806250000000006 36.0 36.0 36.0 32.0 36.0 48-49 34.822125 36.0 36.0 36.0 34.0 36.0 50-51 34.722 36.0 36.0 36.0 32.0 36.0 52-53 34.78675 36.0 36.0 36.0 34.0 36.0 54-55 34.699 36.0 36.0 36.0 32.0 36.0 56-57 34.692499999999995 36.0 36.0 36.0 34.0 36.0 58-59 34.5015 36.0 36.0 36.0 32.0 36.0 60-61 34.5955 36.0 36.0 36.0 32.0 36.0 62-63 34.4835 36.0 36.0 36.0 32.0 36.0 64-65 34.46725 36.0 36.0 36.0 32.0 36.0 66-67 34.37375 36.0 36.0 36.0 32.0 36.0 68-69 34.56725 36.0 36.0 36.0 32.0 36.0 70-71 34.277375 36.0 36.0 36.0 32.0 36.0 72-73 34.336 36.0 36.0 36.0 32.0 36.0 74-75 34.235749999999996 36.0 36.0 36.0 32.0 36.0 76-77 34.19425 36.0 36.0 36.0 32.0 36.0 78-79 34.277125 36.0 36.0 36.0 32.0 36.0 80-81 34.175125 36.0 36.0 36.0 32.0 36.0 82-83 34.123125 36.0 36.0 36.0 32.0 36.0 84-85 34.13425 36.0 36.0 36.0 32.0 36.0 86-87 34.04575 36.0 36.0 36.0 32.0 36.0 88-89 34.184875000000005 36.0 36.0 36.0 32.0 36.0 90-91 34.049875 36.0 36.0 36.0 32.0 36.0 92-93 34.131125 36.0 36.0 36.0 32.0 36.0 94-95 33.934483620905226 36.0 36.0 36.0 29.5 36.0 96-97 34.02942544491905 36.0 36.0 36.0 32.0 36.0 98-99 34.03875771000358 36.0 36.0 36.0 32.0 36.0 100-101 33.082088705668795 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 3.0 24 7.0 25 13.0 26 30.0 27 27.0 28 53.0 29 66.0 30 96.0 31 144.0 32 167.0 33 296.0 34 611.0 35 2481.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 14.475 18.825 39.375 2 24.099999999999998 20.974999999999998 32.35 22.575 3 25.374999999999996 23.5 24.125 27.0 4 26.200000000000003 30.375000000000004 19.0 24.425 5 26.200000000000003 31.35 20.925 21.525 6 21.117234468937877 34.79458917835671 20.841683366733466 23.246492985971944 7 19.525000000000002 16.975 40.150000000000006 23.35 8 22.6 22.5 25.55 29.349999999999998 9 20.674999999999997 21.625 28.999999999999996 28.7 10-11 24.2625 28.462500000000002 21.4875 25.7875 12-13 23.3375 22.75 26.5125 27.400000000000002 14-15 23.5 24.887500000000003 25.8625 25.75 16-17 24.55 24.075 24.85 26.525 18-19 23.7625 24.9875 25.35 25.900000000000002 20-21 24.2375 25.575 24.762500000000003 25.424999999999997 22-23 25.2375 24.975 24.325 25.4625 24-25 23.8625 25.2125 25.4 25.525 26-27 24.7 25.575 24.1625 25.5625 28-29 24.6875 25.35 24.3625 25.6 30-31 23.3875 25.124999999999996 25.837500000000002 25.650000000000002 32-33 24.3875 25.7 25.05 24.8625 34-35 24.9375 24.7875 25.0125 25.2625 36-37 23.3875 25.624999999999996 25.387500000000003 25.6 38-39 24.587500000000002 25.112499999999997 24.4375 25.8625 40-41 25.1 25.1 24.587500000000002 25.2125 42-43 23.724999999999998 25.0375 25.837500000000002 25.4 44-45 24.575 25.224999999999998 24.5625 25.637500000000003 46-47 24.8625 25.662499999999998 24.375 25.1 48-49 24.875 25.424999999999997 24.587500000000002 25.112499999999997 50-51 25.337500000000002 25.5375 24.55 24.575 52-53 22.787499999999998 26.35 24.05 26.8125 54-55 24.474999999999998 25.8625 24.175 25.4875 56-57 23.8875 25.7375 24.5375 25.837500000000002 58-59 25.15 25.025 24.5375 25.2875 60-61 24.349999999999998 25.525 24.087500000000002 26.0375 62-63 24.7375 24.975 24.775 25.5125 64-65 24.325 25.35 24.675 25.650000000000002 66-67 24.8625 23.925 24.6 26.6125 68-69 25.174999999999997 24.8625 23.65 26.3125 70-71 23.9 25.4625 24.637500000000003 26.0 72-73 24.1375 25.4 24.474999999999998 25.9875 74-75 25.775 25.412499999999998 24.375 24.4375 76-77 24.8625 25.087500000000002 24.25 25.8 78-79 24.175 24.9375 25.025 25.8625 80-81 24.9 24.4375 24.9875 25.674999999999997 82-83 25.337500000000002 24.4125 24.837500000000002 25.412499999999998 84-85 25.0125 24.887500000000003 24.087500000000002 26.0125 86-87 24.8625 25.974999999999998 23.150000000000002 26.0125 88-89 25.8625 24.65 24.05 25.4375 90-91 24.3125 24.637500000000003 25.5625 25.4875 92-93 24.9375 25.087500000000002 24.6875 25.2875 94-95 24.756189047261813 25.11877969492373 24.48112028007002 25.64391097774444 96-97 25.582268970698724 23.97946406210869 24.167292762334082 26.270974204858504 98-99 24.85056594175251 24.265547500953836 25.32112425282971 25.56276230446394 100-101 26.70041126225878 10.756089844985764 30.93957608351787 31.603922809237584 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 2.0 26 2.5 27 1.0 28 3.0 29 6.0 30 9.5 31 11.5 32 14.5 33 20.0 34 23.5 35 30.0 36 39.5 37 48.5 38 79.0 39 107.5 40 121.0 41 140.5 42 161.5 43 184.5 44 195.0 45 194.5 46 193.0 47 182.0 48 166.5 49 166.5 50 160.5 51 137.0 52 132.5 53 123.5 54 110.5 55 106.0 56 92.5 57 86.5 58 86.5 59 78.0 60 77.0 61 71.5 62 55.0 63 52.5 64 57.5 65 60.5 66 53.5 67 47.0 68 41.5 69 43.5 70 40.0 71 29.5 72 26.5 73 28.0 74 23.5 75 15.5 76 14.5 77 13.0 78 9.0 79 6.0 80 5.5 81 4.5 82 3.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 1.0 91 1.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 93 1.0 94 0.0 95 1.0 96 10.0 97 23.0 98 67.0 99 263.0 100 948.0 101 2687.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5541561712846348 1.0999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 5 0.125 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503769 spots for SRR21853473.sra Written 503769 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra Read 503750 spots for SRR21853473.sra Written 503750 spots for SRR21853473.sra SRR ids: ['SRR21853473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3wxu7_jq SRR21853473.sra spots: 10075019 blocks: [[1, 503750], [503751, 1007500], [1007501, 1511250], [1511251, 2015000], [2015001, 2518750], [2518751, 3022500], [3022501, 3526250], [3526251, 4030000], [4030001, 4533750], [4533751, 5037500], [5037501, 5541250], [5541251, 6045000], [6045001, 6548750], [6548751, 7052500], [7052501, 7556250], [7556251, 8060000], [8060001, 8563750], [8563751, 9067500], [9067501, 9571250], [9571251, 10075019]] SRR21853473 file size 2745918 SRR21853473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853473 SRR21853473_1.fastq Input file: SRR21853473_1.fastq trimmed: SRR21853473-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:39:52 2024 >> started Fri Dec 6 15:39:58 2024 >> done (5.825s) 10075019 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 17368 ( 0.17%) empty reads filtered out after trimming by size control 10057642 (99.83%) reads available; of these: 84 ( 0.00%) trimmed reads available after processing 10057558 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 28 2 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 5 0.00% 33 0 0.00% 34 0 0.00% 35 15 0.00% 36 16 0.00% 37 9 0.00% 38 22 0.00% 39 16 0.00% 40 18 0.00% 41 17 0.00% 42 22 0.00% 43 17 0.00% 44 21 0.00% 45 21 0.00% 46 25 0.00% 47 24 0.00% 48 22 0.00% 49 20 0.00% 50 20 0.00% 51 20 0.00% 52 37 0.00% 53 28 0.00% 54 24 0.00% 55 27 0.00% 56 36 0.00% 57 25 0.00% 58 43 0.00% 59 36 0.00% 60 38 0.00% 61 36 0.00% 62 39 0.00% 63 34 0.00% 64 29 0.00% 65 46 0.00% 66 36 0.00% 67 29 0.00% 68 39 0.00% 69 43 0.00% 70 36 0.00% 71 49 0.00% 72 41 0.00% 73 44 0.00% 74 39 0.00% 75 54 0.00% 76 66 0.00% 77 45 0.00% 78 55 0.00% 79 67 0.00% 80 44 0.00% 81 47 0.00% 82 66 0.00% 83 75 0.00% 84 71 0.00% 85 61 0.00% 86 89 0.00% 87 83 0.00% 88 103 0.00% 89 110 0.00% 90 160 0.00% 91 358 0.00% 92 129 0.00% 93 191 0.00% 94 550 0.01% 95 2223 0.02% 96 13446 0.13% 97 48798 0.49% 98 187605 1.87% 99 667837 6.64% 100 2351949 23.38% 101 6782193 67.43% 10057642 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=13 prefix-density=0.38 prefix-fanout=1.9 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=174.65 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=22.2 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:40:19 Started mapping on | Dec 06 15:40:19 Finished on | Dec 06 15:40:36 Mapping speed, Million of reads per hour | 2129.85 Number of input reads | 10057642 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 9566659 Uniquely mapped reads % | 95.12% Average mapped length | 100.27 Number of splices: Total | 3593715 Number of splices: Annotated (sjdb) | 3418460 Number of splices: GT/AG | 3545706 Number of splices: GC/AG | 43092 Number of splices: AT/AC | 2160 Number of splices: Non-canonical | 2757 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237373 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 142249 % of reads mapped to too many loci | 1.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.96% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 253610 253610 253610 N_multimapping 237373 237373 237373 N_noFeature 406215 4925312 4917823 N_ambiguous 147904 9403 9847 UnstrandedReadsAssigned:9012540 PositiveStrandReadsAssigned:4631944 NegativeStrandReadsAssigned:4638989 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853473 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853473-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,057,642 reads, 9,310,266 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR21853473.ke.tsv 35125 SRR21853473.se.tsv 88098 total ==> SRR21853473.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 25.864 5.18345 PNS24249 1928 1829 82.9613 8.59046 PNS24246 1044 945 25.864 5.18345 PNS24248 1044 945 25.864 5.18345 PNS24244 1471 1372 23.4467 3.23655 PNS24243 293 194 7 6.83362 KQK14069 1603 1504 1512.72 190.487 KQK14071 474 375 183.24 92.5433 ==> SRR21853473.se.tsv <== BRADI_1g14170v3 1936 BRADI_1g53295v3 73 BRADI_1g59795v3 147 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 1202 BRADI_1g74790v3 93 BRADI_1g09890v3 2 BRADI_1g77505v3 140 BRADI_1g48960v3 1 SRR21853473 completed mapping pipeline successfully