Starting /dee2/code/volunteer_pipeline.sh SRR21853474 current disk space = 1550399864832 free memory = 1599646208 SRR21853474 SRAfilesize bfeef1b60aba743345ef10940df51ae5 SRR21853474.sra SRR21853474.sra file validated SRR21853474 is single end SRR21853474 is conventional basespace SRR21853474 read1 length is 84-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 84-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2505 37.0 37.0 37.0 37.0 37.0 2 35.03675 37.0 37.0 37.0 25.0 37.0 3 35.7175 37.0 37.0 37.0 37.0 37.0 4 35.746 37.0 37.0 37.0 37.0 37.0 5 35.955 37.0 37.0 37.0 37.0 37.0 6 35.927 37.0 37.0 37.0 37.0 37.0 7 35.5445 37.0 37.0 37.0 37.0 37.0 8 35.9465 37.0 37.0 37.0 37.0 37.0 9 35.9415 37.0 37.0 37.0 37.0 37.0 10-11 35.93675 37.0 37.0 37.0 37.0 37.0 12-13 35.92725 37.0 37.0 37.0 37.0 37.0 14-15 35.97 37.0 37.0 37.0 37.0 37.0 16-17 35.86825 37.0 37.0 37.0 37.0 37.0 18-19 35.886250000000004 37.0 37.0 37.0 37.0 37.0 20-21 35.907250000000005 37.0 37.0 37.0 37.0 37.0 22-23 35.951 37.0 37.0 37.0 37.0 37.0 24-25 35.84 37.0 37.0 37.0 37.0 37.0 26-27 35.79474999999999 37.0 37.0 37.0 37.0 37.0 28-29 35.68 37.0 37.0 37.0 37.0 37.0 30-31 35.678 37.0 37.0 37.0 37.0 37.0 32-33 35.7525 37.0 37.0 37.0 37.0 37.0 34-35 35.61625 37.0 37.0 37.0 37.0 37.0 36-37 35.7325 37.0 37.0 37.0 37.0 37.0 38-39 35.82125 37.0 37.0 37.0 37.0 37.0 40-41 35.705 37.0 37.0 37.0 37.0 37.0 42-43 35.664249999999996 37.0 37.0 37.0 37.0 37.0 44-45 35.626000000000005 37.0 37.0 37.0 37.0 37.0 46-47 35.63175 37.0 37.0 37.0 37.0 37.0 48-49 35.605000000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.56575 37.0 37.0 37.0 37.0 37.0 52-53 35.575 37.0 37.0 37.0 37.0 37.0 54-55 35.609750000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.54 37.0 37.0 37.0 37.0 37.0 58-59 35.55975 37.0 37.0 37.0 37.0 37.0 60-61 35.56325 37.0 37.0 37.0 37.0 37.0 62-63 35.46875 37.0 37.0 37.0 37.0 37.0 64-65 35.49625 37.0 37.0 37.0 37.0 37.0 66-67 35.50625 37.0 37.0 37.0 37.0 37.0 68-69 35.414 37.0 37.0 37.0 37.0 37.0 70-71 35.45975 37.0 37.0 37.0 37.0 37.0 72-73 35.4315 37.0 37.0 37.0 37.0 37.0 74-75 35.449 37.0 37.0 37.0 37.0 37.0 76-77 35.2945 37.0 37.0 37.0 31.0 37.0 78-79 35.45 37.0 37.0 37.0 37.0 37.0 80-81 35.52375 37.0 37.0 37.0 37.0 37.0 82-83 35.301249999999996 37.0 37.0 37.0 31.0 37.0 84-85 35.2577688172043 37.0 37.0 37.0 31.0 37.0 86-87 35.305826456614156 37.0 37.0 37.0 37.0 37.0 88-89 35.38959739934984 37.0 37.0 37.0 37.0 37.0 90-91 35.293323330832706 37.0 37.0 37.0 31.0 37.0 92-93 35.36409102275569 37.0 37.0 37.0 37.0 37.0 94-95 35.26081520380095 37.0 37.0 37.0 37.0 37.0 96-97 35.338504087849245 37.0 37.0 37.0 37.0 37.0 98-99 35.33175144214027 37.0 37.0 37.0 37.0 37.0 100-101 35.2659595730006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 3.0 24 4.0 25 10.0 26 18.0 27 15.0 28 33.0 29 42.0 30 82.0 31 106.0 32 145.0 33 163.0 34 250.0 35 453.0 36 2110.0 37 561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.7 13.5 18.625 38.175 2 26.61596958174905 20.811153358681874 30.950570342205324 21.622306717363752 3 25.3 26.05 23.599999999999998 25.05 4 26.200000000000003 30.575000000000003 19.0 24.224999999999998 5 26.625 31.5 21.55 20.325 6 21.925 32.5 22.425 23.150000000000002 7 19.3 17.549999999999997 38.95 24.2 8 23.5 22.575 24.474999999999998 29.45 9 21.15 21.375 28.499999999999996 28.975 10-11 26.125 29.2375 20.5 24.1375 12-13 23.575 22.5875 26.424999999999997 27.4125 14-15 22.7375 24.65 26.6625 25.95 16-17 23.9375 24.65 25.924999999999997 25.4875 18-19 23.8125 25.1 26.337500000000002 24.75 20-21 25.1875 24.75 25.724999999999998 24.337500000000002 22-23 23.3625 26.700000000000003 25.087500000000002 24.85 24-25 23.6875 24.637500000000003 26.1 25.575 26-27 24.8625 25.3 24.3875 25.45 28-29 24.1875 25.5625 25.874999999999996 24.375 30-31 24.25 25.0375 25.4625 25.25 32-33 24.462500000000002 26.0625 25.025 24.45 34-35 22.625 26.174999999999997 25.2 26.0 36-37 24.7 24.3125 26.275 24.712500000000002 38-39 24.8125 24.3 25.0625 25.825 40-41 23.75 25.4 25.5 25.35 42-43 24.0 24.975 25.3125 25.7125 44-45 24.4375 25.362499999999997 25.45 24.75 46-47 24.3125 25.8 24.962500000000002 24.925 48-49 24.175 25.45 25.6125 24.762500000000003 50-51 23.875 25.8625 24.6 25.662499999999998 52-53 24.375 25.424999999999997 24.85 25.35 54-55 24.1875 25.1875 24.1375 26.487500000000004 56-57 24.65 25.224999999999998 25.137500000000003 24.9875 58-59 24.85 25.7875 24.0375 25.324999999999996 60-61 24.525 24.837500000000002 24.9375 25.7 62-63 24.3125 25.724999999999998 25.5125 24.45 64-65 24.8125 24.725 24.825 25.637500000000003 66-67 24.4125 25.5625 24.712500000000002 25.3125 68-69 25.074999999999996 24.587500000000002 24.7 25.637500000000003 70-71 25.162499999999998 24.2875 25.4875 25.0625 72-73 25.7 25.637500000000003 24.975 23.6875 74-75 24.9875 25.025 25.5625 24.425 76-77 24.5625 25.15 25.7125 24.575 78-79 25.224999999999998 23.9875 25.2875 25.5 80-81 25.7875 25.337500000000002 24.462500000000002 24.4125 82-83 26.0625 24.0375 25.4625 24.4375 84-85 25.21565195649456 24.803100387548444 25.065633204150515 24.915614451806476 86-87 24.69367341835459 24.943735933983497 25.468867216804203 24.893723430857715 88-89 25.30632658164541 25.03125781445361 24.956239059764943 24.706176544136035 90-91 25.156289072268066 26.006501625406354 24.143535883970994 24.69367341835459 92-93 24.893723430857715 24.69367341835459 24.968742185546386 25.44386096524131 94-95 25.506376594148538 25.03125781445361 24.131032758189548 25.331332833208304 96-97 26.032024018013512 25.006254691018263 24.193144858643983 24.768576432324245 98-99 25.797432964798578 23.96746727665523 25.212860592197227 25.022239166348964 100-101 26.979844469131887 10.680844310426917 31.471195048405015 30.868116172036185 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9.0 1 8.0 2 5.0 3 2.5 4 1.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 1.5 27 6.0 28 6.0 29 7.0 30 11.5 31 11.5 32 15.5 33 18.0 34 24.0 35 35.0 36 42.5 37 55.0 38 71.0 39 86.5 40 105.5 41 141.0 42 156.5 43 154.0 44 167.0 45 180.5 46 197.5 47 197.0 48 183.0 49 169.5 50 159.5 51 148.5 52 138.0 53 131.5 54 124.5 55 115.0 56 99.0 57 93.5 58 87.5 59 72.0 60 69.5 61 68.5 62 63.5 63 73.5 64 78.5 65 57.0 66 42.5 67 49.5 68 54.0 69 43.0 70 33.0 71 29.5 72 20.5 73 15.5 74 16.0 75 14.5 76 9.5 77 8.0 78 5.0 79 2.5 80 2.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 4.0 97 21.0 98 79.0 99 266.0 100 957.0 101 2672.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 92.23221586263287 84.6 2 7.222676478604524 13.25 3 0.4088307440719542 1.125 4 0.05451076587626057 0.2 5 0.027255382938130283 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05451076587626057 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 15 0.375 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 13 0.325 TruSeq Adapter, Index 13 (97% over 38bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093747 spots for SRR21853474.sra Written 1093747 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra Read 1093729 spots for SRR21853474.sra Written 1093729 spots for SRR21853474.sra SRR ids: ['SRR21853474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b6n02xa5 SRR21853474.sra spots: 21874598 blocks: [[1, 1093729], [1093730, 2187458], [2187459, 3281187], [3281188, 4374916], [4374917, 5468645], [5468646, 6562374], [6562375, 7656103], [7656104, 8749832], [8749833, 9843561], [9843562, 10937290], [10937291, 12031019], [12031020, 13124748], [13124749, 14218477], [14218478, 15312206], [15312207, 16405935], [16405936, 17499664], [17499665, 18593393], [18593394, 19687122], [19687123, 20780851], [20780852, 21874598]] SRR21853474 file size 5894067 SRR21853474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853474 SRR21853474_1.fastq Input file: SRR21853474_1.fastq trimmed: SRR21853474-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:42:54 2024 >> started Fri Dec 6 15:43:11 2024 >> done (16.558s) 21874598 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 90118 ( 0.41%) empty reads filtered out after trimming by size control 21784473 (99.59%) reads available; of these: 438 ( 0.00%) trimmed reads available after processing 21784035 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 5 0.00% 24 4 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 7 0.00% 29 5 0.00% 30 3 0.00% 31 2 0.00% 32 4 0.00% 33 7 0.00% 34 5 0.00% 35 62 0.00% 36 50 0.00% 37 63 0.00% 38 67 0.00% 39 69 0.00% 40 73 0.00% 41 68 0.00% 42 81 0.00% 43 85 0.00% 44 81 0.00% 45 70 0.00% 46 74 0.00% 47 88 0.00% 48 96 0.00% 49 108 0.00% 50 101 0.00% 51 119 0.00% 52 102 0.00% 53 114 0.00% 54 136 0.00% 55 147 0.00% 56 131 0.00% 57 127 0.00% 58 147 0.00% 59 163 0.00% 60 175 0.00% 61 173 0.00% 62 146 0.00% 63 168 0.00% 64 170 0.00% 65 175 0.00% 66 166 0.00% 67 214 0.00% 68 183 0.00% 69 204 0.00% 70 235 0.00% 71 219 0.00% 72 208 0.00% 73 227 0.00% 74 223 0.00% 75 247 0.00% 76 237 0.00% 77 283 0.00% 78 275 0.00% 79 277 0.00% 80 344 0.00% 81 286 0.00% 82 400 0.00% 83 351 0.00% 84 364 0.00% 85 406 0.00% 86 437 0.00% 87 492 0.00% 88 480 0.00% 89 530 0.00% 90 698 0.00% 91 1454 0.01% 92 724 0.00% 93 865 0.00% 94 1580 0.01% 95 5141 0.02% 96 29926 0.14% 97 108915 0.50% 98 416512 1.91% 99 1474909 6.77% 100 5146411 23.62% 101 14586562 66.96% 21784473 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.11 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=196.24 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=20.5 sequence=CCGCCGCCGCCA Started job on | Dec 06 15:43:27 Started mapping on | Dec 06 15:43:27 Finished on | Dec 06 15:44:06 Mapping speed, Million of reads per hour | 2010.87 Number of input reads | 21784473 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19539365 Uniquely mapped reads % | 89.69% Average mapped length | 100.19 Number of splices: Total | 7242013 Number of splices: Annotated (sjdb) | 6846147 Number of splices: GT/AG | 7145791 Number of splices: GC/AG | 79225 Number of splices: AT/AC | 4241 Number of splices: Non-canonical | 12756 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 734672 % of reads mapped to multiple loci | 3.37% Number of reads mapped to too many loci | 824674 % of reads mapped to too many loci | 3.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1510436 1510436 1510436 N_multimapping 734672 734672 734672 N_noFeature 1014825 10104063 10199109 N_ambiguous 289876 19181 21629 UnstrandedReadsAssigned:18234664 PositiveStrandReadsAssigned:9416121 NegativeStrandReadsAssigned:9318627 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853474 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853474-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,784,473 reads, 18,982,529 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR21853474.ke.tsv 35125 SRR21853474.se.tsv 88098 total ==> SRR21853474.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 145.534 16.322 PNS24247 1044 945 42.5102 4.22276 PNS24249 1928 1829 108.244 5.55552 PNS24246 1044 945 42.5102 4.22276 PNS24248 1044 945 42.5102 4.22276 PNS24244 1471 1372 55.6917 3.81041 PNS24243 293 194 8 3.871 KQK14069 1603 1504 2944.43 183.776 KQK14071 474 375 773.155 193.54 ==> SRR21853474.se.tsv <== BRADI_1g14170v3 4131 BRADI_1g53295v3 161 BRADI_1g59795v3 560 BRADI_1g07683v3 0 BRADI_1g00485v3 52 BRADI_1g20270v3 283 BRADI_1g74790v3 218 BRADI_1g09890v3 0 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR21853474 completed mapping pipeline successfully