Starting /dee2/code/volunteer_pipeline.sh SRR21853475 current disk space = 1550413180928 free memory = 1599349616 SRR21853475 SRAfilesize 4d49d0cd0d8d67bb8d404c8b3ea4b92c SRR21853475.sra SRR21853475.sra file validated SRR21853475 is single end SRR21853475 is conventional basespace SRR21853475 read1 length is 76-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 76-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.195 37.0 37.0 37.0 25.0 37.0 2 34.973 37.0 37.0 37.0 25.0 37.0 3 35.637 37.0 37.0 37.0 37.0 37.0 4 35.813 37.0 37.0 37.0 37.0 37.0 5 35.8115 37.0 37.0 37.0 37.0 37.0 6 35.939 37.0 37.0 37.0 37.0 37.0 7 35.6665 37.0 37.0 37.0 37.0 37.0 8 35.7765 37.0 37.0 37.0 37.0 37.0 9 35.814 37.0 37.0 37.0 37.0 37.0 10-11 35.90575 37.0 37.0 37.0 37.0 37.0 12-13 35.787000000000006 37.0 37.0 37.0 37.0 37.0 14-15 35.81425 37.0 37.0 37.0 37.0 37.0 16-17 35.863 37.0 37.0 37.0 37.0 37.0 18-19 35.86825 37.0 37.0 37.0 37.0 37.0 20-21 35.87125 37.0 37.0 37.0 37.0 37.0 22-23 35.797 37.0 37.0 37.0 37.0 37.0 24-25 35.78425 37.0 37.0 37.0 37.0 37.0 26-27 35.708 37.0 37.0 37.0 37.0 37.0 28-29 35.646 37.0 37.0 37.0 37.0 37.0 30-31 35.644 37.0 37.0 37.0 37.0 37.0 32-33 35.696 37.0 37.0 37.0 37.0 37.0 34-35 35.663250000000005 37.0 37.0 37.0 37.0 37.0 36-37 35.610749999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.63375 37.0 37.0 37.0 37.0 37.0 40-41 35.5135 37.0 37.0 37.0 37.0 37.0 42-43 35.59775 37.0 37.0 37.0 37.0 37.0 44-45 35.4395 37.0 37.0 37.0 37.0 37.0 46-47 35.430499999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.536500000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.551 37.0 37.0 37.0 37.0 37.0 52-53 35.368 37.0 37.0 37.0 37.0 37.0 54-55 35.486999999999995 37.0 37.0 37.0 37.0 37.0 56-57 35.52075 37.0 37.0 37.0 37.0 37.0 58-59 35.45825000000001 37.0 37.0 37.0 37.0 37.0 60-61 35.4015 37.0 37.0 37.0 37.0 37.0 62-63 35.3255 37.0 37.0 37.0 37.0 37.0 64-65 35.44775 37.0 37.0 37.0 37.0 37.0 66-67 35.3905 37.0 37.0 37.0 37.0 37.0 68-69 35.2585 37.0 37.0 37.0 31.0 37.0 70-71 35.21025 37.0 37.0 37.0 31.0 37.0 72-73 35.283249999999995 37.0 37.0 37.0 37.0 37.0 74-75 35.43375 37.0 37.0 37.0 37.0 37.0 76-77 35.17651769192298 37.0 37.0 37.0 25.0 37.0 78-79 35.24006001500375 37.0 37.0 37.0 37.0 37.0 80-81 35.406601650412604 37.0 37.0 37.0 37.0 37.0 82-83 35.29857464366091 37.0 37.0 37.0 37.0 37.0 84-85 35.25106276569143 37.0 37.0 37.0 31.0 37.0 86-87 35.30482620655164 37.0 37.0 37.0 31.0 37.0 88-89 35.2736368184092 37.0 37.0 37.0 37.0 37.0 90-91 35.23067300475357 37.0 37.0 37.0 31.0 37.0 92-93 35.197447447447445 37.0 37.0 37.0 31.0 37.0 94-95 35.2497922202553 37.0 37.0 37.0 31.0 37.0 96-97 35.16830304736696 37.0 37.0 37.0 31.0 37.0 98-99 35.298952023192236 37.0 37.0 37.0 31.0 37.0 100-101 35.080186409983 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 0.0 23 4.0 24 5.0 25 13.0 26 19.0 27 29.0 28 42.0 29 54.0 30 87.0 31 81.0 32 128.0 33 193.0 34 266.0 35 460.0 36 2120.0 37 496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.625 15.375 17.974999999999998 39.025 2 24.94934143870314 20.89665653495441 33.86524822695036 20.288753799392097 3 24.099999999999998 25.624999999999996 26.724999999999998 23.549999999999997 4 25.25 30.9 20.275000000000002 23.575 5 26.0 32.6 22.0 19.400000000000002 6 21.95 33.675 23.025000000000002 21.349999999999998 7 18.65 17.25 42.075 22.025 8 22.675 22.825 26.650000000000002 27.85 9 20.125 22.225 30.049999999999997 27.6 10-11 25.0375 28.9125 22.15 23.9 12-13 21.4 24.212500000000002 27.875 26.5125 14-15 22.662499999999998 25.5375 27.6875 24.1125 16-17 23.2375 26.174999999999997 25.7375 24.85 18-19 23.3 25.825 25.937500000000004 24.9375 20-21 23.65 25.887500000000003 25.874999999999996 24.587500000000002 22-23 22.4375 27.8875 25.85 23.825 24-25 23.0625 26.937499999999996 26.325 23.674999999999997 26-27 23.1875 26.85 26.200000000000003 23.7625 28-29 22.725 27.0 25.825 24.45 30-31 23.625 26.224999999999998 26.4125 23.7375 32-33 23.200000000000003 27.5125 25.3125 23.974999999999998 34-35 23.275000000000002 26.0625 26.7625 23.9 36-37 21.7 26.275 27.4125 24.6125 38-39 23.2375 26.35 25.7875 24.625 40-41 24.05 26.25 25.912499999999998 23.7875 42-43 23.8625 25.637500000000003 26.5625 23.9375 44-45 22.1 26.9625 27.224999999999998 23.7125 46-47 23.775 25.837500000000002 25.587500000000002 24.8 48-49 22.975 26.437500000000004 26.5 24.087500000000002 50-51 23.5375 26.775 25.775 23.9125 52-53 23.7 27.4125 25.837500000000002 23.05 54-55 23.025000000000002 26.187500000000004 26.337500000000002 24.45 56-57 22.412499999999998 26.200000000000003 26.687499999999996 24.7 58-59 23.4125 26.674999999999997 25.9625 23.95 60-61 23.4875 26.387500000000003 26.825 23.3 62-63 22.925 25.337500000000002 26.9625 24.775 64-65 24.212500000000002 26.224999999999998 26.424999999999997 23.1375 66-67 23.2625 26.5 26.1 24.1375 68-69 24.025 26.674999999999997 25.387500000000003 23.9125 70-71 24.0 25.775 26.825 23.400000000000002 72-73 23.6125 27.737499999999997 24.85 23.799999999999997 74-75 24.5125 26.9625 25.75 22.775000000000002 76-77 23.29041130141268 25.84073009126141 27.353419177397175 23.51543942992874 78-79 23.380845211302827 25.831457864466117 26.144036009002253 24.643660915228807 80-81 23.13078269567392 26.056514128532132 26.86921730432608 23.943485871467868 82-83 23.93098274568642 26.556639159789945 26.356589147286826 23.15578894723681 84-85 24.3935983995999 26.44411102775694 26.319079769942487 22.843210802700675 86-87 24.76869217304326 26.469117279319832 26.19404851212803 22.568142035508878 88-89 23.04902451225613 25.86293146573287 27.101050525262632 23.986993496748372 90-91 23.204903677758317 25.969477107830873 27.207905929447087 23.617713284963724 92-93 24.91241241241241 26.18868868868869 25.45045045045045 23.44844844844845 94-95 24.18971342760606 25.929170316606182 25.76648729821049 24.114628957577274 96-97 24.207889793362554 25.835942391984972 25.698184095178462 24.257983719474012 98-99 23.312101910828027 25.783439490445858 27.019108280254777 23.88535031847134 100-101 24.724836497048972 12.10719412984527 32.700590205774446 30.467379167331316 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 6.5 2 3.5 3 1.5 4 1.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 3.0 25 3.0 26 3.0 27 6.0 28 6.5 29 9.0 30 12.0 31 14.5 32 23.0 33 30.5 34 36.0 35 43.0 36 63.0 37 85.0 38 96.5 39 114.5 40 147.0 41 161.5 42 174.0 43 204.0 44 217.0 45 227.0 46 221.5 47 199.5 48 186.0 49 184.5 50 174.0 51 144.5 52 124.0 53 111.0 54 104.5 55 95.5 56 85.5 57 80.5 58 70.5 59 62.0 60 50.5 61 36.0 62 33.5 63 41.5 64 42.5 65 37.0 66 34.0 67 33.0 68 26.0 69 18.5 70 16.5 71 15.0 72 12.0 73 14.5 74 14.0 75 7.0 76 7.0 77 7.5 78 3.0 79 1.0 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 1.0 88 0.0 89 1.0 90 0.0 91 1.0 92 0.0 93 0.0 94 1.0 95 2.0 96 1.0 97 24.0 98 86.0 99 255.0 100 985.0 101 2642.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6207270754205 85.35000000000001 2 6.809549647314162 12.55 3 0.4612045577862181 1.275 4 0.02712967986977754 0.1 5 0.02712967986977754 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05425935973955508 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 13 0.325 TruSeq Adapter, Index 13 (97% over 38bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCGCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029677 spots for SRR21853475.sra Written 1029677 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra Read 1029671 spots for SRR21853475.sra Written 1029671 spots for SRR21853475.sra SRR ids: ['SRR21853475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__78hgfec SRR21853475.sra spots: 20593426 blocks: [[1, 1029671], [1029672, 2059342], [2059343, 3089013], [3089014, 4118684], [4118685, 5148355], [5148356, 6178026], [6178027, 7207697], [7207698, 8237368], [8237369, 9267039], [9267040, 10296710], [10296711, 11326381], [11326382, 12356052], [12356053, 13385723], [13385724, 14415394], [14415395, 15445065], [15445066, 16474736], [16474737, 17504407], [17504408, 18534078], [18534079, 19563749], [19563750, 20593426]] SRR21853475 file size 5547482 SRR21853475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853475 SRR21853475_1.fastq Input file: SRR21853475_1.fastq trimmed: SRR21853475-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:42:14 2024 >> started Fri Dec 6 15:42:24 2024 >> done (9.873s) 20593426 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 86310 ( 0.42%) empty reads filtered out after trimming by size control 20507107 (99.58%) reads available; of these: 342 ( 0.00%) trimmed reads available after processing 20506765 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 0 0.00% 27 4 0.00% 28 3 0.00% 29 2 0.00% 30 5 0.00% 31 5 0.00% 32 3 0.00% 33 5 0.00% 34 5 0.00% 35 39 0.00% 36 50 0.00% 37 78 0.00% 38 80 0.00% 39 59 0.00% 40 89 0.00% 41 58 0.00% 42 87 0.00% 43 71 0.00% 44 66 0.00% 45 74 0.00% 46 76 0.00% 47 73 0.00% 48 82 0.00% 49 99 0.00% 50 103 0.00% 51 119 0.00% 52 120 0.00% 53 124 0.00% 54 111 0.00% 55 108 0.00% 56 116 0.00% 57 120 0.00% 58 133 0.00% 59 135 0.00% 60 202 0.00% 61 186 0.00% 62 179 0.00% 63 172 0.00% 64 188 0.00% 65 225 0.00% 66 161 0.00% 67 201 0.00% 68 238 0.00% 69 202 0.00% 70 222 0.00% 71 230 0.00% 72 219 0.00% 73 245 0.00% 74 263 0.00% 75 243 0.00% 76 263 0.00% 77 295 0.00% 78 327 0.00% 79 328 0.00% 80 401 0.00% 81 365 0.00% 82 374 0.00% 83 475 0.00% 84 464 0.00% 85 458 0.00% 86 530 0.00% 87 507 0.00% 88 553 0.00% 89 617 0.00% 90 821 0.00% 91 1354 0.01% 92 732 0.00% 93 950 0.00% 94 1590 0.01% 95 4776 0.02% 96 28450 0.14% 97 108724 0.53% 98 409279 2.00% 99 1399141 6.82% 100 5044074 24.60% 101 13495570 65.81% 20507107 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.08 prefix-fanout=1.9 sequence=AGAGGCAGCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=143.00 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=18.3 sequence=CGCCGCCGCCGT Started job on | Dec 06 15:42:45 Started mapping on | Dec 06 15:42:46 Finished on | Dec 06 15:43:18 Mapping speed, Million of reads per hour | 2307.05 Number of input reads | 20507107 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18769411 Uniquely mapped reads % | 91.53% Average mapped length | 100.20 Number of splices: Total | 7296990 Number of splices: Annotated (sjdb) | 6919342 Number of splices: GT/AG | 7201805 Number of splices: GC/AG | 80463 Number of splices: AT/AC | 4504 Number of splices: Non-canonical | 10218 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 581388 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 571577 % of reads mapped to too many loci | 2.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1156308 1156308 1156308 N_multimapping 581388 581388 581388 N_noFeature 1094161 9777280 9853415 N_ambiguous 272993 20080 22155 UnstrandedReadsAssigned:17402257 PositiveStrandReadsAssigned:8972051 NegativeStrandReadsAssigned:8893841 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853475 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853475-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,507,107 reads, 18,077,566 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52973 SRR21853475.ke.tsv 35125 SRR21853475.se.tsv 88098 total ==> SRR21853475.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.8938e-06 2.38358e-07 PNS24247 1044 945 68.8515 7.67547 PNS24249 1928 1829 48.4353 2.78979 PNS24246 1044 945 68.8515 7.67547 PNS24248 1044 945 68.8515 7.67547 PNS24244 1471 1372 79.0101 6.06669 PNS24243 293 194 9 4.88724 KQK14069 1603 1504 2042.56 143.07 KQK14071 474 375 455.926 128.081 ==> SRR21853475.se.tsv <== BRADI_1g14170v3 2925 BRADI_1g53295v3 122 BRADI_1g59795v3 653 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 266 BRADI_1g74790v3 119 BRADI_1g09890v3 0 BRADI_1g77505v3 212 BRADI_1g48960v3 0 SRR21853475 completed mapping pipeline successfully