Starting /dee2/code/volunteer_pipeline.sh SRR21853476 current disk space = 1550398971904 free memory = 1599811868 SRR21853476 SRAfilesize 28e8ca6053a02bef65dabf1d6a08c90d SRR21853476.sra SRR21853476.sra file validated SRR21853476 is single end SRR21853476 is conventional basespace SRR21853476 read1 length is 63-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 63-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.4555 37.0 37.0 37.0 37.0 37.0 2 35.7065 37.0 37.0 37.0 37.0 37.0 3 35.8455 37.0 37.0 37.0 37.0 37.0 4 35.7845 37.0 37.0 37.0 37.0 37.0 5 35.8605 37.0 37.0 37.0 37.0 37.0 6 36.0605 37.0 37.0 37.0 37.0 37.0 7 35.9205 37.0 37.0 37.0 37.0 37.0 8 35.8965 37.0 37.0 37.0 37.0 37.0 9 35.816 37.0 37.0 37.0 37.0 37.0 10-11 35.9445 37.0 37.0 37.0 37.0 37.0 12-13 35.94 37.0 37.0 37.0 37.0 37.0 14-15 35.92075 37.0 37.0 37.0 37.0 37.0 16-17 35.91175 37.0 37.0 37.0 37.0 37.0 18-19 35.8475 37.0 37.0 37.0 37.0 37.0 20-21 35.86450000000001 37.0 37.0 37.0 37.0 37.0 22-23 35.88375 37.0 37.0 37.0 37.0 37.0 24-25 35.934 37.0 37.0 37.0 37.0 37.0 26-27 35.7945 37.0 37.0 37.0 37.0 37.0 28-29 35.76375 37.0 37.0 37.0 37.0 37.0 30-31 35.765249999999995 37.0 37.0 37.0 37.0 37.0 32-33 35.68925 37.0 37.0 37.0 37.0 37.0 34-35 35.698 37.0 37.0 37.0 37.0 37.0 36-37 35.54275 37.0 37.0 37.0 37.0 37.0 38-39 35.633750000000006 37.0 37.0 37.0 37.0 37.0 40-41 35.703 37.0 37.0 37.0 37.0 37.0 42-43 35.6475 37.0 37.0 37.0 37.0 37.0 44-45 35.667 37.0 37.0 37.0 37.0 37.0 46-47 35.638999999999996 37.0 37.0 37.0 37.0 37.0 48-49 35.61475 37.0 37.0 37.0 37.0 37.0 50-51 35.6045 37.0 37.0 37.0 37.0 37.0 52-53 35.659 37.0 37.0 37.0 37.0 37.0 54-55 35.6455 37.0 37.0 37.0 37.0 37.0 56-57 35.706 37.0 37.0 37.0 37.0 37.0 58-59 35.58075 37.0 37.0 37.0 37.0 37.0 60-61 35.58175 37.0 37.0 37.0 37.0 37.0 62-63 35.581 37.0 37.0 37.0 37.0 37.0 64-65 35.573954206410534 37.0 37.0 37.0 37.0 37.0 66-67 35.57803901950976 37.0 37.0 37.0 37.0 37.0 68-69 35.57803901950975 37.0 37.0 37.0 37.0 37.0 70-71 35.59254627313656 37.0 37.0 37.0 37.0 37.0 72-73 35.537518759379694 37.0 37.0 37.0 37.0 37.0 74-75 35.46879550608429 37.0 37.0 37.0 37.0 37.0 76-77 35.49612209156868 37.0 37.0 37.0 37.0 37.0 78-79 35.53528528528528 37.0 37.0 37.0 37.0 37.0 80-81 35.576826826826824 37.0 37.0 37.0 37.0 37.0 82-83 35.630630630630634 37.0 37.0 37.0 37.0 37.0 84-85 35.58716895869587 37.0 37.0 37.0 37.0 37.0 86-87 35.49211514392991 37.0 37.0 37.0 37.0 37.0 88-89 35.4162703379224 37.0 37.0 37.0 37.0 37.0 90-91 35.51520929704945 37.0 37.0 37.0 37.0 37.0 92-93 35.3620430645969 37.0 37.0 37.0 31.0 37.0 94-95 35.41462193289935 37.0 37.0 37.0 37.0 37.0 96-97 35.31785133000787 37.0 37.0 37.0 37.0 37.0 98-99 35.422832024268416 37.0 37.0 37.0 37.0 37.0 100-101 35.1819956428004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 5.0 24 9.0 25 4.0 26 14.0 27 26.0 28 34.0 29 44.0 30 75.0 31 96.0 32 133.0 33 145.0 34 221.0 35 436.0 36 2155.0 37 600.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.425 18.125 14.45 40.0 2 26.474999999999998 20.200000000000003 25.2 28.125 3 26.424999999999997 16.775000000000002 22.35 34.449999999999996 4 28.599999999999998 19.925 19.650000000000002 31.825 5 31.25 24.8 19.925 24.025 6 26.25 29.525000000000002 19.950000000000003 24.275 7 22.725 22.6 34.0 20.674999999999997 8 23.05 24.5 25.775 26.674999999999997 9 22.425 22.925 28.475 26.174999999999997 10-11 24.837500000000002 28.625 22.1375 24.4 12-13 24.375 24.725 25.112499999999997 25.7875 14-15 24.4375 24.099999999999998 24.712500000000002 26.75 16-17 25.4375 23.7625 24.4875 26.3125 18-19 25.5625 24.712500000000002 23.5875 26.137500000000003 20-21 24.887500000000003 24.8 23.775 26.5375 22-23 25.25 24.575 23.775 26.400000000000002 24-25 24.9375 25.0 23.6875 26.375 26-27 25.587500000000002 24.2375 23.9125 26.2625 28-29 25.662499999999998 24.4 23.875 26.0625 30-31 24.6125 24.1125 24.1375 27.1375 32-33 24.1125 25.1 23.7875 27.0 34-35 24.625 25.2875 24.6 25.4875 36-37 24.224999999999998 24.8125 24.575 26.387500000000003 38-39 25.55 25.025 23.9125 25.5125 40-41 25.362499999999997 25.112499999999997 23.1875 26.337500000000002 42-43 25.674999999999997 24.212500000000002 24.887500000000003 25.224999999999998 44-45 25.275 24.9375 23.9125 25.874999999999996 46-47 25.224999999999998 24.7875 23.125 26.8625 48-49 24.712500000000002 25.224999999999998 23.8875 26.174999999999997 50-51 25.937500000000004 24.125 23.7 26.237500000000004 52-53 24.8625 23.849999999999998 23.849999999999998 27.437499999999996 54-55 25.0375 24.474999999999998 23.7375 26.75 56-57 24.2875 24.9875 23.8375 26.887499999999996 58-59 25.575 23.3 24.1125 27.0125 60-61 25.474999999999998 24.2625 24.7875 25.474999999999998 62-63 25.5375 24.3125 23.075000000000003 27.075 64-65 25.35950981618107 24.65924721770664 24.27160185069401 25.70964111541828 66-67 23.949474737368686 24.974987493746873 24.299649824912457 26.775887943971988 68-69 25.83791895947974 25.250125062531264 23.299149574787396 25.6128064032016 70-71 25.03751875937969 25.162581290645324 23.974487243621812 25.82541270635318 72-73 25.100050025012504 24.574787393696848 24.324662331165584 26.000500250125064 74-75 26.00375234521576 23.639774859287055 23.439649781113197 26.91682301438399 76-77 25.8443832874656 23.91793845384038 24.31823867900926 25.91943957968476 78-79 25.775775775775777 23.7987987987988 24.61211211211211 25.813313313313312 80-81 25.95095095095095 23.485985985985984 24.0990990990991 26.463963963963966 82-83 25.975975975975974 24.24924924924925 23.536036036036037 26.238738738738736 84-85 25.328494556375926 24.18971342760606 23.814291077462144 26.667500938555875 86-87 26.533166458072593 24.81852315394243 23.942428035043804 24.705882352941178 88-89 26.12015018773467 23.667083854818525 23.867334167709636 26.345431789737173 90-91 26.874452372011515 24.345975716610337 23.30704718988609 25.47252472149205 92-93 26.552328492739107 24.236354531797698 23.673009514271406 25.53830746119179 94-95 26.12669003505258 24.399098647971957 23.56034051076615 25.913870806209317 96-97 25.72323105823419 24.207889793362554 24.53350031308704 25.53537883531622 98-99 25.808907499048345 22.928562365182085 24.425834284989214 26.836695850780355 100-101 27.578124999999996 9.90625 29.421874999999996 33.09375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 2.0 28 5.0 29 6.0 30 11.0 31 12.5 32 12.0 33 18.0 34 24.0 35 32.0 36 40.5 37 48.0 38 70.5 39 87.5 40 107.0 41 133.0 42 155.0 43 170.0 44 163.5 45 170.5 46 178.5 47 177.0 48 167.5 49 153.5 50 139.0 51 135.5 52 129.0 53 101.5 54 89.5 55 87.0 56 83.0 57 69.0 58 58.5 59 76.5 60 86.5 61 78.0 62 67.0 63 71.5 64 76.0 65 72.5 66 73.5 67 65.0 68 59.0 69 62.5 70 63.5 71 58.5 72 52.5 73 40.5 74 35.0 75 33.0 76 26.0 77 17.5 78 15.0 79 12.0 80 4.5 81 5.0 82 5.5 83 2.5 84 2.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 63 1.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 1.0 75 0.0 76 0.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 1.0 96 1.0 97 17.0 98 69.0 99 267.0 100 878.0 101 2761.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.6855600539811 85.85000000000001 2 6.774628879892037 12.55 3 0.5128205128205128 1.425 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026990553306342778 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229621 spots for SRR21853476.sra Written 229621 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra Read 229613 spots for SRR21853476.sra Written 229613 spots for SRR21853476.sra SRR ids: ['SRR21853476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bs6ekzr8 SRR21853476.sra spots: 4592268 blocks: [[1, 229613], [229614, 459226], [459227, 688839], [688840, 918452], [918453, 1148065], [1148066, 1377678], [1377679, 1607291], [1607292, 1836904], [1836905, 2066517], [2066518, 2296130], [2296131, 2525743], [2525744, 2755356], [2755357, 2984969], [2984970, 3214582], [3214583, 3444195], [3444196, 3673808], [3673809, 3903421], [3903422, 4133034], [4133035, 4362647], [4362648, 4592268]] SRR21853476 file size 1233664 SRR21853476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853476 SRR21853476_1.fastq Input file: SRR21853476_1.fastq trimmed: SRR21853476-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:43:00 2024 >> started Fri Dec 6 15:43:03 2024 >> done (2.700s) 4592268 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 14661 ( 0.32%) empty reads filtered out after trimming by size control 4577600 (99.68%) reads available; of these: 211 ( 0.00%) trimmed reads available after processing 4577389 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 4 0.00% 32 2 0.00% 33 4 0.00% 34 4 0.00% 35 42 0.00% 36 39 0.00% 37 40 0.00% 38 54 0.00% 39 67 0.00% 40 53 0.00% 41 52 0.00% 42 65 0.00% 43 40 0.00% 44 50 0.00% 45 51 0.00% 46 43 0.00% 47 45 0.00% 48 49 0.00% 49 82 0.00% 50 67 0.00% 51 50 0.00% 52 82 0.00% 53 82 0.00% 54 73 0.00% 55 59 0.00% 56 89 0.00% 57 91 0.00% 58 87 0.00% 59 81 0.00% 60 139 0.00% 61 124 0.00% 62 136 0.00% 63 136 0.00% 64 151 0.00% 65 122 0.00% 66 142 0.00% 67 131 0.00% 68 148 0.00% 69 135 0.00% 70 171 0.00% 71 197 0.00% 72 174 0.00% 73 210 0.00% 74 245 0.01% 75 250 0.01% 76 215 0.00% 77 246 0.01% 78 240 0.01% 79 274 0.01% 80 268 0.01% 81 343 0.01% 82 348 0.01% 83 360 0.01% 84 391 0.01% 85 368 0.01% 86 390 0.01% 87 411 0.01% 88 436 0.01% 89 519 0.01% 90 470 0.01% 91 707 0.02% 92 653 0.01% 93 638 0.01% 94 862 0.02% 95 1787 0.04% 96 7871 0.17% 97 21391 0.47% 98 83696 1.83% 99 304850 6.66% 100 1019902 22.28% 101 3125800 68.28% 4577600 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=30 prefix-density=0.26 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=165.44 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=21.5 sequence=CCGCCGCCGCCG Started job on | Dec 06 15:43:26 Started mapping on | Dec 06 15:43:27 Finished on | Dec 06 15:43:37 Mapping speed, Million of reads per hour | 1647.94 Number of input reads | 4577600 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4376933 Uniquely mapped reads % | 95.62% Average mapped length | 100.17 Number of splices: Total | 1513964 Number of splices: Annotated (sjdb) | 1440920 Number of splices: GT/AG | 1492456 Number of splices: GC/AG | 18708 Number of splices: AT/AC | 726 Number of splices: Non-canonical | 2074 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 84802 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 38364 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 115865 115865 115865 N_multimapping 84802 84802 84802 N_noFeature 185783 2273039 2230712 N_ambiguous 67716 4819 4395 UnstrandedReadsAssigned:4123434 PositiveStrandReadsAssigned:2099075 NegativeStrandReadsAssigned:2141826 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853476 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853476-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,577,600 reads, 4,215,863 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR21853476.ke.tsv 35125 SRR21853476.se.tsv 88098 total ==> SRR21853476.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.22914e-07 3.47726e-07 PNS24247 1044 945 15.0671 6.41912 PNS24249 1928 1829 25.5186 5.6172 PNS24246 1044 945 15.0671 6.41912 PNS24248 1044 945 15.0671 6.41912 PNS24244 1471 1372 8.27993 2.42968 PNS24243 293 194 5 10.3763 KQK14069 1603 1504 2223.29 595.148 KQK14071 474 375 526.995 565.785 ==> SRR21853476.se.tsv <== BRADI_1g14170v3 3181 BRADI_1g53295v3 18 BRADI_1g59795v3 127 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 447 BRADI_1g74790v3 18 BRADI_1g09890v3 1 BRADI_1g77505v3 102 BRADI_1g48960v3 0 SRR21853476 completed mapping pipeline successfully