Starting /dee2/code/volunteer_pipeline.sh SRR21853477 current disk space = 1550354833408 free memory = 1599038760 SRR21853477 SRAfilesize f3018af294e6bba6fb2e2153e6b9ce8f SRR21853477.sra SRR21853477.sra file validated SRR21853477 is single end SRR21853477 is conventional basespace SRR21853477 read1 length is 58-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 58-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2525 37.0 37.0 37.0 37.0 37.0 2 34.87375 37.0 37.0 37.0 25.0 37.0 3 35.687 37.0 37.0 37.0 37.0 37.0 4 35.668 37.0 37.0 37.0 37.0 37.0 5 35.875 37.0 37.0 37.0 37.0 37.0 6 35.753 37.0 37.0 37.0 37.0 37.0 7 35.652 37.0 37.0 37.0 37.0 37.0 8 35.7655 37.0 37.0 37.0 37.0 37.0 9 35.871 37.0 37.0 37.0 37.0 37.0 10-11 35.876 37.0 37.0 37.0 37.0 37.0 12-13 35.861000000000004 37.0 37.0 37.0 37.0 37.0 14-15 35.7545 37.0 37.0 37.0 37.0 37.0 16-17 35.8425 37.0 37.0 37.0 37.0 37.0 18-19 35.8845 37.0 37.0 37.0 37.0 37.0 20-21 35.8285 37.0 37.0 37.0 37.0 37.0 22-23 35.8315 37.0 37.0 37.0 37.0 37.0 24-25 35.826499999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.681 37.0 37.0 37.0 37.0 37.0 28-29 35.725 37.0 37.0 37.0 37.0 37.0 30-31 35.67675 37.0 37.0 37.0 37.0 37.0 32-33 35.555 37.0 37.0 37.0 37.0 37.0 34-35 35.544 37.0 37.0 37.0 37.0 37.0 36-37 35.522 37.0 37.0 37.0 37.0 37.0 38-39 35.695750000000004 37.0 37.0 37.0 37.0 37.0 40-41 35.61775 37.0 37.0 37.0 37.0 37.0 42-43 35.431250000000006 37.0 37.0 37.0 37.0 37.0 44-45 35.55200000000001 37.0 37.0 37.0 37.0 37.0 46-47 35.562250000000006 37.0 37.0 37.0 37.0 37.0 48-49 35.458 37.0 37.0 37.0 37.0 37.0 50-51 35.628 37.0 37.0 37.0 37.0 37.0 52-53 35.45675 37.0 37.0 37.0 37.0 37.0 54-55 35.564 37.0 37.0 37.0 37.0 37.0 56-57 35.5185 37.0 37.0 37.0 37.0 37.0 58-59 35.53031982995749 37.0 37.0 37.0 37.0 37.0 60-61 35.48368532853574 37.0 37.0 37.0 37.0 37.0 62-63 35.38769384692346 37.0 37.0 37.0 37.0 37.0 64-65 35.29221916437328 37.0 37.0 37.0 31.0 37.0 66-67 35.45809357017763 37.0 37.0 37.0 37.0 37.0 68-69 35.32074055541656 37.0 37.0 37.0 31.0 37.0 70-71 35.34478818322951 37.0 37.0 37.0 37.0 37.0 72-73 35.33888431610585 37.0 37.0 37.0 37.0 37.0 74-75 35.30863579474343 37.0 37.0 37.0 37.0 37.0 76-77 35.29061326658323 37.0 37.0 37.0 31.0 37.0 78-79 35.267122398240666 37.0 37.0 37.0 31.0 37.0 80-81 35.485227841762644 37.0 37.0 37.0 37.0 37.0 82-83 35.306246748033395 37.0 37.0 37.0 37.0 37.0 84-85 35.231222165725626 37.0 37.0 37.0 31.0 37.0 86-87 35.23903783512904 37.0 37.0 37.0 25.0 37.0 88-89 35.27794486215539 37.0 37.0 37.0 31.0 37.0 90-91 35.30630141410181 37.0 37.0 37.0 37.0 37.0 92-93 35.24993732765104 37.0 37.0 37.0 31.0 37.0 94-95 35.1973656107525 37.0 37.0 37.0 31.0 37.0 96-97 35.07937031781754 37.0 37.0 37.0 25.0 37.0 98-99 35.22179790800536 37.0 37.0 37.0 31.0 37.0 100-101 35.101661453868104 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 2.0 23 6.0 24 4.0 25 7.0 26 14.0 27 24.0 28 30.0 29 52.0 30 87.0 31 109.0 32 139.0 33 195.0 34 247.0 35 524.0 36 2047.0 37 510.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.275 16.925 14.299999999999999 41.5 2 26.182646091576018 18.41639261320516 24.05767771312927 31.343283582089555 3 26.8 17.575 22.025 33.6 4 29.049999999999997 19.525000000000002 18.975 32.45 5 31.2 23.849999999999998 20.65 24.3 6 27.175 30.65 19.15 23.025000000000002 7 23.225 23.3 32.775 20.7 8 23.075000000000003 23.775 25.95 27.200000000000003 9 22.85 22.1 28.95 26.1 10-11 25.8625 27.462500000000002 22.112499999999997 24.5625 12-13 24.8125 22.875 25.8 26.5125 14-15 24.675 24.8 25.2125 25.3125 16-17 25.525 23.95 24.025 26.5 18-19 25.0375 23.35 24.637500000000003 26.974999999999998 20-21 25.1875 24.837500000000002 24.0 25.974999999999998 22-23 24.675 25.7 24.0 25.624999999999996 24-25 25.25 24.212500000000002 24.25 26.2875 26-27 24.875 24.5625 24.625 25.937500000000004 28-29 25.162499999999998 24.6125 23.5125 26.7125 30-31 25.124999999999996 23.849999999999998 24.6 26.424999999999997 32-33 24.825 24.099999999999998 23.5375 27.537499999999998 34-35 25.0625 25.0 24.1375 25.8 36-37 25.0 24.65 24.675 25.674999999999997 38-39 25.637500000000003 24.4 23.75 26.2125 40-41 25.2375 24.1875 24.725 25.85 42-43 25.724999999999998 24.099999999999998 24.474999999999998 25.7 44-45 25.2 24.25 23.925 26.625 46-47 25.0375 24.712500000000002 23.9875 26.2625 48-49 25.387500000000003 24.15 24.4 26.0625 50-51 25.575 25.2 23.825 25.4 52-53 24.887500000000003 25.374999999999996 23.400000000000002 26.337500000000002 54-55 25.025 24.474999999999998 24.587500000000002 25.912499999999998 56-57 24.7375 25.25 23.724999999999998 26.2875 58-59 25.26565820727591 24.640580072509064 24.20302537817227 25.890736342042754 60-61 24.52169563586345 25.04689258471927 24.034012754783042 26.39739902463424 62-63 24.974987493746873 24.937468734367183 23.724362181090545 26.3631815907954 64-65 24.931198398799097 24.993745308981737 23.91793845384038 26.157117838378785 66-67 24.96872654490868 24.893670252689517 23.792844633475106 26.344758568926697 68-69 24.931198398799097 24.88116087065299 24.055541656242184 26.13209907430573 70-71 26.86100337795571 23.570624296259226 24.183660703115226 25.384711622669837 72-73 24.30234013264923 25.103241146289573 24.452509072706796 26.1419096483544 74-75 25.36921151439299 23.85481852315394 23.92991239048811 26.846057571964955 76-77 25.64455569461827 24.6558197747184 23.817271589486857 25.882352941176475 78-79 25.57266241081487 24.24583802728752 24.170734760295407 26.010764801602203 80-81 26.139208813219827 23.985978968452677 23.5728592889334 26.30195292939409 82-83 25.278577688744207 24.301990734944283 23.488168273444344 26.93126330286716 84-85 24.611723446893787 24.223446893787575 24.19839679358717 26.966432865731466 86-87 25.507391631170133 23.365071410674016 24.968679528940115 26.158857429215736 88-89 26.027568922305765 23.984962406015036 24.110275689223055 25.877192982456144 90-91 26.080962526632412 23.13573129464845 24.351422484020553 26.431883694698584 92-93 26.021559288042116 24.22913010779644 24.12885434946102 25.620456254700425 94-95 24.952978056426332 23.97492163009404 23.824451410658305 27.247648902821314 96-97 25.65004396432609 24.695390026378597 23.8914709207386 25.763095088556714 98-99 25.13082322910019 23.267389917038926 24.492661135928525 27.109125717932354 100-101 28.305165060811877 9.77728636866214 30.263781393144846 31.65376717738114 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 1.5 28 3.0 29 4.5 30 8.0 31 12.0 32 17.5 33 18.0 34 23.0 35 33.5 36 47.0 37 52.0 38 57.0 39 83.0 40 110.5 41 115.5 42 143.0 43 173.0 44 173.0 45 176.0 46 168.5 47 170.0 48 166.5 49 157.5 50 148.0 51 130.0 52 125.5 53 111.5 54 93.0 55 93.5 56 93.5 57 83.0 58 78.5 59 86.5 60 82.5 61 73.5 62 69.0 63 73.5 64 71.5 65 60.5 66 72.0 67 77.0 68 66.0 69 61.5 70 56.5 71 49.0 72 49.0 73 40.0 74 30.0 75 30.0 76 21.5 77 13.0 78 12.0 79 10.5 80 6.5 81 6.0 82 4.5 83 2.0 84 1.5 85 1.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 58 1.0 59 0.0 60 1.0 61 0.0 62 0.0 63 1.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 0.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 1.0 79 0.0 80 0.0 81 0.0 82 1.0 83 0.0 84 2.0 85 0.0 86 0.0 87 1.0 88 0.0 89 0.0 90 1.0 91 0.0 92 0.0 93 1.0 94 1.0 95 4.0 96 5.0 97 25.0 98 71.0 99 300.0 100 833.0 101 2749.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.88601455133387 86.175 2 6.682834815413635 12.4 3 0.37725680409593104 1.05 4 0.026946914578280787 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026946914578280787 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752325 spots for SRR21853477.sra Written 752325 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra Read 752307 spots for SRR21853477.sra Written 752307 spots for SRR21853477.sra SRR ids: ['SRR21853477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7wu65_v SRR21853477.sra spots: 15046158 blocks: [[1, 752307], [752308, 1504614], [1504615, 2256921], [2256922, 3009228], [3009229, 3761535], [3761536, 4513842], [4513843, 5266149], [5266150, 6018456], [6018457, 6770763], [6770764, 7523070], [7523071, 8275377], [8275378, 9027684], [9027685, 9779991], [9779992, 10532298], [10532299, 11284605], [11284606, 12036912], [12036913, 12789219], [12789220, 13541526], [13541527, 14293833], [14293834, 15046158]] SRR21853477 file size 4047981 SRR21853477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853477 SRR21853477_1.fastq Input file: SRR21853477_1.fastq trimmed: SRR21853477-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:46:45 2024 >> started Fri Dec 6 15:46:52 2024 >> done (7.681s) 15046158 reads processed; of these: 32 ( 0.00%) short reads filtered out after trimming by size control 74379 ( 0.49%) empty reads filtered out after trimming by size control 14971747 (99.51%) reads available; of these: 541 ( 0.00%) trimmed reads available after processing 14971206 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 4 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 4 0.00% 27 4 0.00% 28 11 0.00% 29 4 0.00% 30 6 0.00% 31 6 0.00% 32 5 0.00% 33 3 0.00% 34 8 0.00% 35 222 0.00% 36 228 0.00% 37 242 0.00% 38 215 0.00% 39 250 0.00% 40 260 0.00% 41 264 0.00% 42 278 0.00% 43 303 0.00% 44 272 0.00% 45 283 0.00% 46 296 0.00% 47 310 0.00% 48 330 0.00% 49 408 0.00% 50 354 0.00% 51 384 0.00% 52 409 0.00% 53 427 0.00% 54 383 0.00% 55 436 0.00% 56 424 0.00% 57 477 0.00% 58 487 0.00% 59 536 0.00% 60 597 0.00% 61 705 0.00% 62 692 0.00% 63 732 0.00% 64 711 0.00% 65 734 0.00% 66 806 0.01% 67 758 0.01% 68 802 0.01% 69 915 0.01% 70 879 0.01% 71 1044 0.01% 72 1046 0.01% 73 1166 0.01% 74 1168 0.01% 75 1132 0.01% 76 1244 0.01% 77 1246 0.01% 78 1253 0.01% 79 1370 0.01% 80 1485 0.01% 81 1635 0.01% 82 1856 0.01% 83 2037 0.01% 84 2165 0.01% 85 1941 0.01% 86 2055 0.01% 87 2146 0.01% 88 2231 0.01% 89 2353 0.02% 90 2474 0.02% 91 3095 0.02% 92 3053 0.02% 93 3260 0.02% 94 3997 0.03% 95 6945 0.05% 96 26176 0.17% 97 71283 0.48% 98 275079 1.84% 99 999360 6.67% 100 3314873 22.14% 101 10214686 68.23% 14971747 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=187.41 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=22.8 sequence=CCGCCGCCGCCG Started job on | Dec 06 15:47:10 Started mapping on | Dec 06 15:47:10 Finished on | Dec 06 15:47:29 Mapping speed, Million of reads per hour | 2836.75 Number of input reads | 14971747 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14351777 Uniquely mapped reads % | 95.86% Average mapped length | 100.13 Number of splices: Total | 4974644 Number of splices: Annotated (sjdb) | 4733932 Number of splices: GT/AG | 4903308 Number of splices: GC/AG | 61180 Number of splices: AT/AC | 2479 Number of splices: Non-canonical | 7677 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280610 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 124275 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.31% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 339360 339360 339360 N_multimapping 280610 280610 280610 N_noFeature 595694 7395504 7356907 N_ambiguous 223591 15818 14196 UnstrandedReadsAssigned:13532492 PositiveStrandReadsAssigned:6940455 NegativeStrandReadsAssigned:6980674 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853477 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853477-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,971,747 reads, 13,841,689 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR21853477.ke.tsv 35125 SRR21853477.se.tsv 88098 total ==> SRR21853477.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 26.0765 3.34836 PNS24249 1928 1829 130.581 8.66323 PNS24246 1044 945 26.0765 3.34836 PNS24248 1044 945 26.0765 3.34836 PNS24244 1471 1372 40.1898 3.55448 PNS24243 293 194 12 7.50575 KQK14069 1603 1504 7705.61 621.69 KQK14071 474 375 1917.32 620.41 ==> SRR21853477.se.tsv <== BRADI_1g14170v3 11075 BRADI_1g53295v3 70 BRADI_1g59795v3 386 BRADI_1g07683v3 0 BRADI_1g00485v3 70 BRADI_1g20270v3 1412 BRADI_1g74790v3 64 BRADI_1g09890v3 6 BRADI_1g77505v3 277 BRADI_1g48960v3 0 SRR21853477 completed mapping pipeline successfully