Starting /dee2/code/volunteer_pipeline.sh SRR21853478 current disk space = 1550348767232 free memory = 1598592816 SRR21853478 SRAfilesize 0ee19cd63c4fe173988255c150ff8781 SRR21853478.sra SRR21853478.sra file validated SRR21853478 is single end SRR21853478 is conventional basespace SRR21853478 read1 length is 94-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 94-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.921 37.0 37.0 37.0 25.0 37.0 2 34.84225 37.0 37.0 37.0 25.0 37.0 3 35.4375 37.0 37.0 37.0 37.0 37.0 4 35.684 37.0 37.0 37.0 37.0 37.0 5 35.645 37.0 37.0 37.0 37.0 37.0 6 35.733 37.0 37.0 37.0 37.0 37.0 7 35.502 37.0 37.0 37.0 37.0 37.0 8 35.722 37.0 37.0 37.0 37.0 37.0 9 35.745 37.0 37.0 37.0 37.0 37.0 10-11 35.794 37.0 37.0 37.0 37.0 37.0 12-13 35.79175 37.0 37.0 37.0 37.0 37.0 14-15 35.8305 37.0 37.0 37.0 37.0 37.0 16-17 35.769000000000005 37.0 37.0 37.0 37.0 37.0 18-19 35.7405 37.0 37.0 37.0 37.0 37.0 20-21 35.7615 37.0 37.0 37.0 37.0 37.0 22-23 35.747 37.0 37.0 37.0 37.0 37.0 24-25 35.775999999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.67175 37.0 37.0 37.0 37.0 37.0 28-29 35.586 37.0 37.0 37.0 37.0 37.0 30-31 35.548500000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.512 37.0 37.0 37.0 37.0 37.0 34-35 35.485 37.0 37.0 37.0 37.0 37.0 36-37 35.58825 37.0 37.0 37.0 37.0 37.0 38-39 35.497249999999994 37.0 37.0 37.0 37.0 37.0 40-41 35.54175 37.0 37.0 37.0 37.0 37.0 42-43 35.3715 37.0 37.0 37.0 37.0 37.0 44-45 35.348749999999995 37.0 37.0 37.0 31.0 37.0 46-47 35.334500000000006 37.0 37.0 37.0 37.0 37.0 48-49 35.3845 37.0 37.0 37.0 37.0 37.0 50-51 35.43075 37.0 37.0 37.0 37.0 37.0 52-53 35.3455 37.0 37.0 37.0 31.0 37.0 54-55 35.448 37.0 37.0 37.0 37.0 37.0 56-57 35.3605 37.0 37.0 37.0 37.0 37.0 58-59 35.482 37.0 37.0 37.0 37.0 37.0 60-61 35.46425 37.0 37.0 37.0 37.0 37.0 62-63 35.255 37.0 37.0 37.0 31.0 37.0 64-65 35.360749999999996 37.0 37.0 37.0 37.0 37.0 66-67 35.26575 37.0 37.0 37.0 31.0 37.0 68-69 35.23225 37.0 37.0 37.0 31.0 37.0 70-71 35.26775 37.0 37.0 37.0 37.0 37.0 72-73 35.25075 37.0 37.0 37.0 31.0 37.0 74-75 35.336 37.0 37.0 37.0 31.0 37.0 76-77 35.133 37.0 37.0 37.0 31.0 37.0 78-79 35.23725 37.0 37.0 37.0 31.0 37.0 80-81 35.378249999999994 37.0 37.0 37.0 37.0 37.0 82-83 35.280249999999995 37.0 37.0 37.0 37.0 37.0 84-85 35.1355 37.0 37.0 37.0 25.0 37.0 86-87 35.197 37.0 37.0 37.0 25.0 37.0 88-89 35.224999999999994 37.0 37.0 37.0 25.0 37.0 90-91 35.231750000000005 37.0 37.0 37.0 31.0 37.0 92-93 35.209500000000006 37.0 37.0 37.0 25.0 37.0 94-95 35.12801862965742 37.0 37.0 37.0 25.0 37.0 96-97 35.13477493970955 37.0 37.0 37.0 25.0 37.0 98-99 35.04862724636736 37.0 37.0 37.0 25.0 37.0 100-101 35.12545825988287 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 6.0 24 3.0 25 18.0 26 18.0 27 23.0 28 34.0 29 63.0 30 76.0 31 91.0 32 174.0 33 200.0 34 276.0 35 564.0 36 2032.0 37 421.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.225 13.65 18.325 38.800000000000004 2 25.221350872754872 20.288388565646347 30.685555274475085 23.804705287123703 3 25.0 23.625 25.05 26.325 4 28.525 27.675 18.075 25.724999999999998 5 28.4 30.349999999999998 18.975 22.275 6 21.45 34.8 20.275000000000002 23.474999999999998 7 20.75 15.7 38.85 24.7 8 21.4 22.05 24.099999999999998 32.45 9 21.8 19.950000000000003 29.275000000000002 28.975 10-11 25.900000000000002 27.287499999999998 20.5125 26.3 12-13 23.75 21.712500000000002 25.900000000000002 28.6375 14-15 23.962500000000002 24.9 24.525 26.6125 16-17 25.15 23.3875 24.474999999999998 26.987499999999997 18-19 25.387500000000003 23.8875 24.4375 26.2875 20-21 24.875 23.7 25.0 26.424999999999997 22-23 24.762500000000003 24.9 24.175 26.1625 24-25 25.1 25.2125 23.35 26.337500000000002 26-27 24.5625 24.775 23.2375 27.425 28-29 25.1875 24.587500000000002 24.3875 25.837500000000002 30-31 24.4125 25.2875 24.375 25.924999999999997 32-33 24.9125 25.2375 23.9125 25.937500000000004 34-35 24.925 24.7875 23.775 26.5125 36-37 24.962500000000002 24.8 24.2875 25.95 38-39 25.45 24.349999999999998 24.4375 25.7625 40-41 24.887500000000003 24.3875 23.849999999999998 26.875 42-43 24.525 24.575 24.2625 26.637499999999996 44-45 24.5625 24.075 24.45 26.9125 46-47 25.8125 24.75 23.7625 25.674999999999997 48-49 24.65 25.525 23.4125 26.4125 50-51 24.9125 24.925 24.275 25.887500000000003 52-53 24.875 25.137500000000003 23.8125 26.174999999999997 54-55 24.8 23.6375 24.887500000000003 26.674999999999997 56-57 23.325000000000003 25.8625 24.637500000000003 26.174999999999997 58-59 24.825 24.5 24.575 26.1 60-61 25.887500000000003 24.5375 23.1375 26.437500000000004 62-63 25.224999999999998 24.6125 24.125 26.0375 64-65 26.337500000000002 25.174999999999997 23.0625 25.424999999999997 66-67 25.587500000000002 23.95 24.099999999999998 26.3625 68-69 24.55 25.7125 23.599999999999998 26.137500000000003 70-71 26.224999999999998 23.3875 23.474999999999998 26.9125 72-73 25.0375 25.05 24.125 25.7875 74-75 25.8 25.2625 23.1625 25.775 76-77 26.4125 24.8 23.3625 25.424999999999997 78-79 26.2125 23.6875 22.925 27.175 80-81 24.775 24.45 25.887500000000003 24.887500000000003 82-83 25.637500000000003 25.324999999999996 23.3 25.7375 84-85 25.6 23.775 24.2625 26.3625 86-87 25.9625 23.400000000000002 24.224999999999998 26.4125 88-89 25.9875 23.974999999999998 24.3125 25.724999999999998 90-91 26.6625 23.425 23.65 26.2625 92-93 25.55 24.975 23.825 25.650000000000002 94-95 25.703212901612705 23.76547068383548 23.702962870358796 26.828353544193025 96-97 26.59401227608668 23.149192033070275 23.57509708129776 26.681698609545286 98-99 26.198651914027728 22.612234516088005 24.634363474500827 26.55475009538344 100-101 27.098880597014922 10.945273631840797 29.78855721393035 32.16728855721393 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 1.0 27 3.0 28 3.5 29 6.0 30 11.0 31 13.5 32 14.5 33 17.0 34 23.0 35 30.0 36 39.5 37 52.0 38 68.0 39 88.5 40 112.0 41 135.0 42 145.0 43 140.0 44 153.0 45 172.5 46 183.5 47 174.0 48 156.0 49 147.0 50 137.5 51 139.0 52 119.5 53 106.0 54 113.0 55 110.0 56 99.0 57 92.0 58 92.5 59 88.0 60 77.0 61 73.0 62 71.0 63 68.5 64 75.5 65 78.0 66 75.0 67 70.5 68 68.5 69 61.5 70 48.0 71 42.0 72 41.0 73 39.5 74 31.0 75 21.5 76 22.0 77 17.5 78 8.0 79 6.0 80 4.5 81 3.5 82 3.0 83 1.0 84 1.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 94 1.0 95 2.0 96 11.0 97 17.0 98 75.0 99 226.0 100 904.0 101 2764.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.06529951430113 86.225 2 6.341068537506746 11.75 3 0.5396654074473827 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026983270372369132 0.2 9 0.0 0.0 >10 0.026983270372369132 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 13 0.325 TruSeq Adapter, Index 7 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCGCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123703 spots for SRR21853478.sra Written 1123703 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra Read 1123688 spots for SRR21853478.sra Written 1123688 spots for SRR21853478.sra SRR ids: ['SRR21853478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cvrhwo8l SRR21853478.sra spots: 22473775 blocks: [[1, 1123688], [1123689, 2247376], [2247377, 3371064], [3371065, 4494752], [4494753, 5618440], [5618441, 6742128], [6742129, 7865816], [7865817, 8989504], [8989505, 10113192], [10113193, 11236880], [11236881, 12360568], [12360569, 13484256], [13484257, 14607944], [14607945, 15731632], [15731633, 16855320], [16855321, 17979008], [17979009, 19102696], [19102697, 20226384], [20226385, 21350072], [21350073, 22473775]] SRR21853478 file size 6056644 SRR21853478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853478 SRR21853478_1.fastq Input file: SRR21853478_1.fastq trimmed: SRR21853478-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:47:45 2024 >> started Fri Dec 6 15:47:57 2024 >> done (11.790s) 22473775 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 82501 ( 0.37%) empty reads filtered out after trimming by size control 22391264 (99.63%) reads available; of these: 413 ( 0.00%) trimmed reads available after processing 22390851 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 7 0.00% 25 1 0.00% 26 2 0.00% 27 5 0.00% 28 5 0.00% 29 4 0.00% 30 6 0.00% 31 6 0.00% 32 6 0.00% 33 2 0.00% 34 6 0.00% 35 80 0.00% 36 76 0.00% 37 70 0.00% 38 82 0.00% 39 90 0.00% 40 82 0.00% 41 94 0.00% 42 88 0.00% 43 90 0.00% 44 91 0.00% 45 78 0.00% 46 96 0.00% 47 97 0.00% 48 83 0.00% 49 110 0.00% 50 116 0.00% 51 121 0.00% 52 127 0.00% 53 118 0.00% 54 136 0.00% 55 125 0.00% 56 127 0.00% 57 134 0.00% 58 147 0.00% 59 173 0.00% 60 159 0.00% 61 173 0.00% 62 148 0.00% 63 159 0.00% 64 150 0.00% 65 183 0.00% 66 178 0.00% 67 154 0.00% 68 208 0.00% 69 162 0.00% 70 195 0.00% 71 175 0.00% 72 203 0.00% 73 168 0.00% 74 215 0.00% 75 218 0.00% 76 211 0.00% 77 226 0.00% 78 213 0.00% 79 256 0.00% 80 290 0.00% 81 269 0.00% 82 281 0.00% 83 315 0.00% 84 288 0.00% 85 304 0.00% 86 362 0.00% 87 404 0.00% 88 384 0.00% 89 499 0.00% 90 574 0.00% 91 1130 0.01% 92 518 0.00% 93 701 0.00% 94 1524 0.01% 95 5840 0.03% 96 31410 0.14% 97 102327 0.46% 98 402984 1.80% 99 1502803 6.71% 100 5026499 22.45% 101 15305111 68.35% 22391264 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=24 prefix-density=0.30 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=174.02 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=22.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 15:48:13 Started mapping on | Dec 06 15:48:14 Finished on | Dec 06 15:48:45 Mapping speed, Million of reads per hour | 2600.28 Number of input reads | 22391264 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 21108753 Uniquely mapped reads % | 94.27% Average mapped length | 100.22 Number of splices: Total | 7259338 Number of splices: Annotated (sjdb) | 6902130 Number of splices: GT/AG | 7156637 Number of splices: GC/AG | 86759 Number of splices: AT/AC | 3603 Number of splices: Non-canonical | 12339 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568346 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 354817 % of reads mapped to too many loci | 1.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.35% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714165 714165 714165 N_multimapping 568346 568346 568346 N_noFeature 848447 10858831 10816394 N_ambiguous 321385 21178 20320 UnstrandedReadsAssigned:19938921 PositiveStrandReadsAssigned:10228744 NegativeStrandReadsAssigned:10272039 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853478 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853478-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,391,264 reads, 20,502,369 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR21853478.ke.tsv 35125 SRR21853478.se.tsv 88098 total ==> SRR21853478.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 1.41723e-08 1.40236e-09 PNS24247 1044 945 62.9469 5.51682 PNS24249 1928 1829 180.272 8.1632 PNS24246 1044 945 62.9469 5.51682 PNS24248 1044 945 62.9469 5.51682 PNS24244 1471 1372 46.8878 2.83043 PNS24243 293 194 23 9.81913 KQK14069 1603 1504 11672.3 642.767 KQK14071 474 375 2195.53 484.902 ==> SRR21853478.se.tsv <== BRADI_1g14170v3 15502 BRADI_1g53295v3 97 BRADI_1g59795v3 493 BRADI_1g07683v3 0 BRADI_1g00485v3 81 BRADI_1g20270v3 2287 BRADI_1g74790v3 100 BRADI_1g09890v3 7 BRADI_1g77505v3 339 BRADI_1g48960v3 0 SRR21853478 completed mapping pipeline successfully