Starting /dee2/code/volunteer_pipeline.sh SRR21853479 current disk space = 1550414897152 free memory = 1597249444 SRR21853479 SRAfilesize ffec47f3154e0ceb8e9085eff1f3584b SRR21853479.sra SRR21853479.sra file validated SRR21853479 is single end SRR21853479 is conventional basespace SRR21853479 read1 length is 38-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 38-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.3485 37.0 37.0 37.0 37.0 37.0 2 35.652 37.0 37.0 37.0 37.0 37.0 3 35.742 37.0 37.0 37.0 37.0 37.0 4 35.863 37.0 37.0 37.0 37.0 37.0 5 35.8295 37.0 37.0 37.0 37.0 37.0 6 35.925 37.0 37.0 37.0 37.0 37.0 7 35.8435 37.0 37.0 37.0 37.0 37.0 8 35.7615 37.0 37.0 37.0 37.0 37.0 9 35.893 37.0 37.0 37.0 37.0 37.0 10-11 35.99825 37.0 37.0 37.0 37.0 37.0 12-13 35.987 37.0 37.0 37.0 37.0 37.0 14-15 35.92725 37.0 37.0 37.0 37.0 37.0 16-17 35.8575 37.0 37.0 37.0 37.0 37.0 18-19 35.829499999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.81 37.0 37.0 37.0 37.0 37.0 22-23 35.98825 37.0 37.0 37.0 37.0 37.0 24-25 35.749 37.0 37.0 37.0 37.0 37.0 26-27 35.707 37.0 37.0 37.0 37.0 37.0 28-29 35.81 37.0 37.0 37.0 37.0 37.0 30-31 35.676249999999996 37.0 37.0 37.0 37.0 37.0 32-33 35.689 37.0 37.0 37.0 37.0 37.0 34-35 35.617000000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.670500000000004 37.0 37.0 37.0 37.0 37.0 38-39 35.608401575787894 37.0 37.0 37.0 37.0 37.0 40-41 35.67608804402201 37.0 37.0 37.0 37.0 37.0 42-43 35.59954977488744 37.0 37.0 37.0 37.0 37.0 44-45 35.418209104552275 37.0 37.0 37.0 37.0 37.0 46-47 35.59529764882441 37.0 37.0 37.0 37.0 37.0 48-49 35.427463731865934 37.0 37.0 37.0 37.0 37.0 50-51 35.52501250625313 37.0 37.0 37.0 37.0 37.0 52-53 35.55627813906953 37.0 37.0 37.0 37.0 37.0 54-55 35.486993496748376 37.0 37.0 37.0 37.0 37.0 56-57 35.45272636318159 37.0 37.0 37.0 37.0 37.0 58-59 35.41145572786393 37.0 37.0 37.0 37.0 37.0 60-61 35.47148574287144 37.0 37.0 37.0 37.0 37.0 62-63 35.38894447223612 37.0 37.0 37.0 37.0 37.0 64-65 35.491245622811405 37.0 37.0 37.0 37.0 37.0 66-67 35.51550775387694 37.0 37.0 37.0 37.0 37.0 68-69 35.32491245622811 37.0 37.0 37.0 37.0 37.0 70-71 35.37268634317158 37.0 37.0 37.0 37.0 37.0 72-73 35.47348674337169 37.0 37.0 37.0 37.0 37.0 74-75 35.36443221610806 37.0 37.0 37.0 37.0 37.0 76-77 35.44547273636819 37.0 37.0 37.0 37.0 37.0 78-79 35.46810107580686 37.0 37.0 37.0 37.0 37.0 80-81 35.49603652413822 37.0 37.0 37.0 37.0 37.0 82-83 35.49574361542314 37.0 37.0 37.0 37.0 37.0 84-85 35.4849774661993 37.0 37.0 37.0 37.0 37.0 86-87 35.399799599198396 37.0 37.0 37.0 37.0 37.0 88-89 35.358507355477684 37.0 37.0 37.0 37.0 37.0 90-91 35.37308945126534 37.0 37.0 37.0 37.0 37.0 92-93 35.3712709952369 37.0 37.0 37.0 37.0 37.0 94-95 35.28505967891139 37.0 37.0 37.0 31.0 37.0 96-97 35.36051446697752 37.0 37.0 37.0 37.0 37.0 98-99 35.2946180652833 37.0 37.0 37.0 37.0 37.0 100-101 35.27233916035618 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 3.0 23 4.0 24 2.0 25 6.0 26 12.0 27 16.0 28 38.0 29 57.0 30 74.0 31 103.0 32 127.0 33 175.0 34 251.0 35 494.0 36 2115.0 37 518.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.975 18.675 15.049999999999999 38.3 2 25.35 21.575 24.099999999999998 28.975 3 28.025 16.1 23.150000000000002 32.725 4 27.625 18.925 19.15 34.300000000000004 5 29.575000000000003 24.025 21.95 24.45 6 27.1 28.65 20.225 24.025 7 22.325 24.775 32.074999999999996 20.825 8 23.25 25.35 25.3 26.1 9 23.425 23.35 29.325000000000003 23.9 10-11 25.15 28.299999999999997 21.6 24.95 12-13 23.65 24.8 24.975 26.575 14-15 24.4375 24.962500000000002 23.8375 26.7625 16-17 25.224999999999998 24.3 24.3625 26.1125 18-19 23.5375 25.687500000000004 24.7375 26.0375 20-21 24.224999999999998 25.25 24.875 25.650000000000002 22-23 24.9375 26.974999999999998 22.925 25.162499999999998 24-25 24.575 24.712500000000002 24.525 26.187500000000004 26-27 24.45 25.2625 23.4375 26.85 28-29 24.9 25.275 24.0125 25.8125 30-31 24.125 25.025 24.85 26.0 32-33 24.6 24.9875 24.6875 25.724999999999998 34-35 25.5625 25.0625 23.7125 25.662499999999998 36-37 26.487500000000004 24.0125 24.1375 25.362499999999997 38-39 24.893723430857715 23.768442110527634 25.018754688672168 26.319079769942487 40-41 25.350175087543768 24.362181090545274 23.81190595297649 26.475737868934466 42-43 24.399699849924964 25.15007503751876 24.64982491245623 25.80040020010005 44-45 24.674837418709355 25.012506253126567 24.299649824912457 26.013006503251624 46-47 25.025012506253123 24.61230615307654 23.424212106053027 26.93846923461731 48-49 24.912456228114056 25.212606303151574 24.987493746873437 24.88744372186093 50-51 25.72536268134067 24.074537268634316 25.337668834417208 24.862431215607803 52-53 25.200100050025014 23.961980990495245 24.437218609304654 26.40070035017509 54-55 25.76288144072036 24.524762381190595 23.899449724862432 25.812906453226613 56-57 24.974987493746873 24.674837418709355 24.412206103051524 25.937968984492244 58-59 25.26263131565783 23.6368184092046 24.024512256128062 27.07603801900951 60-61 25.237618809404704 24.72486243121561 24.537268634317158 25.50025012506253 62-63 24.499749874937468 24.349674837418707 24.23711855927964 26.91345672836418 64-65 25.52526263131566 24.68734367183592 23.736868434217108 26.050525262631314 66-67 25.050025012506254 26.32566283141571 23.149074537268636 25.475237618809405 68-69 26.300650325162582 26.3631815907954 21.91095547773887 25.42521260630315 70-71 26.20060030015007 23.58679339669835 24.287143571785894 25.925462731365684 72-73 26.900950475237618 24.19959979989995 23.71185592796398 25.18759379689845 74-75 27.151075537768882 24.54977488744372 22.873936968484244 25.42521260630315 76-77 26.513256628314156 23.74937468734367 23.349174587293646 26.388194097048522 78-79 25.894420815611706 23.667750813109834 24.69352014010508 25.74430823117338 80-81 26.292078588411965 24.61519209110249 22.788136653735453 26.304592666750093 82-83 26.752628943415125 23.00951427140711 24.32398597896845 25.913870806209317 84-85 26.4021031547321 24.248873309964946 24.336504757135703 25.01251877816725 86-87 27.17935871743487 24.298597194388776 23.39679358717435 25.125250501002007 88-89 26.919704371790054 23.625203557559814 23.625203557559814 25.829888513090317 90-91 26.898020546229017 24.004009020295666 23.978952643447755 25.119017790027563 92-93 26.53547254951116 24.22913010779644 23.60240661820005 25.632990724492355 94-95 27.416321925535915 24.15695123480005 23.12899586310643 25.297730976557602 96-97 26.75543273458108 23.853787212661725 23.514633839969854 25.876146212787337 98-99 26.305067481538067 23.720397249809015 23.962312197606312 26.012223071046602 100-101 26.435141135426576 11.227402473834443 29.654297494449732 32.68315889628925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 2.0 28 1.5 29 2.0 30 5.5 31 12.5 32 18.0 33 21.5 34 24.5 35 31.0 36 40.5 37 58.5 38 81.0 39 93.0 40 106.0 41 123.5 42 151.0 43 172.0 44 174.5 45 189.5 46 173.0 47 164.0 48 166.5 49 143.5 50 137.5 51 128.0 52 114.0 53 114.5 54 106.5 55 82.5 56 81.0 57 78.5 58 70.5 59 74.0 60 73.5 61 75.5 62 73.5 63 67.5 64 71.5 65 78.5 66 81.0 67 75.0 68 71.5 69 64.0 70 49.0 71 39.0 72 38.5 73 41.5 74 34.5 75 26.5 76 21.0 77 21.0 78 18.0 79 9.0 80 4.5 81 6.0 82 6.5 83 3.0 84 1.5 85 2.0 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 38-39 2.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 3.0 82-83 0.0 84-85 2.0 86-87 0.0 88-89 1.0 90-91 2.0 92-93 0.0 94-95 4.0 96-97 19.0 98-99 361.0 100-101 3605.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.24324324324324 86.25 2 6.351351351351352 11.75 3 0.35135135135135137 0.975 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05405405405405406 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 27 0.675 TruSeq Adapter, Index 7 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCGCGTAT 14 0.35000000000000003 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra Read 253380 spots for SRR21853479.sra Written 253380 spots for SRR21853479.sra Read 253367 spots for SRR21853479.sra Written 253367 spots for SRR21853479.sra SRR ids: ['SRR21853479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g7huz3ci SRR21853479.sra spots: 5067353 blocks: [[1, 253367], [253368, 506734], [506735, 760101], [760102, 1013468], [1013469, 1266835], [1266836, 1520202], [1520203, 1773569], [1773570, 2026936], [2026937, 2280303], [2280304, 2533670], [2533671, 2787037], [2787038, 3040404], [3040405, 3293771], [3293772, 3547138], [3547139, 3800505], [3800506, 4053872], [4053873, 4307239], [4307240, 4560606], [4560607, 4813973], [4813974, 5067353]] SRR21853479 file size 1361059 SRR21853479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853479 SRR21853479_1.fastq Input file: SRR21853479_1.fastq trimmed: SRR21853479-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:49:36 2024 >> started Fri Dec 6 15:49:41 2024 >> done (4.140s) 5067353 reads processed; of these: 14 ( 0.00%) short reads filtered out after trimming by size control 68326 ( 1.35%) empty reads filtered out after trimming by size control 4999013 (98.65%) reads available; of these: 274 ( 0.01%) trimmed reads available after processing 4998739 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 0 0.00% 27 0 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 2 0.00% 33 4 0.00% 34 3 0.00% 35 81 0.00% 36 105 0.00% 37 85 0.00% 38 94 0.00% 39 82 0.00% 40 89 0.00% 41 98 0.00% 42 89 0.00% 43 107 0.00% 44 99 0.00% 45 76 0.00% 46 98 0.00% 47 107 0.00% 48 103 0.00% 49 134 0.00% 50 119 0.00% 51 96 0.00% 52 129 0.00% 53 124 0.00% 54 148 0.00% 55 146 0.00% 56 119 0.00% 57 146 0.00% 58 167 0.00% 59 177 0.00% 60 213 0.00% 61 263 0.01% 62 204 0.00% 63 191 0.00% 64 222 0.00% 65 237 0.00% 66 224 0.00% 67 220 0.00% 68 231 0.00% 69 237 0.00% 70 285 0.01% 71 288 0.01% 72 316 0.01% 73 290 0.01% 74 324 0.01% 75 363 0.01% 76 359 0.01% 77 374 0.01% 78 375 0.01% 79 452 0.01% 80 445 0.01% 81 488 0.01% 82 536 0.01% 83 533 0.01% 84 600 0.01% 85 634 0.01% 86 623 0.01% 87 587 0.01% 88 686 0.01% 89 727 0.01% 90 760 0.02% 91 918 0.02% 92 853 0.02% 93 982 0.02% 94 1133 0.02% 95 2180 0.04% 96 8415 0.17% 97 23848 0.48% 98 92390 1.85% 99 332663 6.65% 100 1108635 22.18% 101 3411863 68.25% 4999013 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=246.90 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=25.1 sequence=GCCGCCGCCACCCT Started job on | Dec 06 15:49:57 Started mapping on | Dec 06 15:49:57 Finished on | Dec 06 15:50:05 Mapping speed, Million of reads per hour | 2249.56 Number of input reads | 4999013 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4820759 Uniquely mapped reads % | 96.43% Average mapped length | 100.13 Number of splices: Total | 1662292 Number of splices: Annotated (sjdb) | 1581164 Number of splices: GT/AG | 1638612 Number of splices: GC/AG | 20085 Number of splices: AT/AC | 946 Number of splices: Non-canonical | 2649 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 80145 % of reads mapped to multiple loci | 1.60% Number of reads mapped to too many loci | 22342 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 98109 98109 98109 N_multimapping 80145 80145 80145 N_noFeature 208173 2440482 2524866 N_ambiguous 73271 5606 4639 UnstrandedReadsAssigned:4539315 PositiveStrandReadsAssigned:2374671 NegativeStrandReadsAssigned:2291254 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853479 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853479-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,999,013 reads, 4,642,946 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52973 SRR21853479.ke.tsv 35125 SRR21853479.se.tsv 88098 total ==> SRR21853479.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 16.3392 7.25659 PNS24247 1044 945 7.29587 2.86995 PNS24249 1928 1829 36.7338 7.46587 PNS24246 1044 945 7.29587 2.86995 PNS24248 1044 945 7.29587 2.86995 PNS24244 1471 1372 4.03944 1.09445 PNS24243 293 194 3 5.74841 KQK14069 1603 1504 2330.55 576.023 KQK14071 474 375 412.181 408.588 ==> SRR21853479.se.tsv <== BRADI_1g14170v3 3098 BRADI_1g53295v3 21 BRADI_1g59795v3 137 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 501 BRADI_1g74790v3 20 BRADI_1g09890v3 0 BRADI_1g77505v3 83 BRADI_1g48960v3 0 SRR21853479 completed mapping pipeline successfully