Starting /dee2/code/volunteer_pipeline.sh SRR21853480 current disk space = 1550432444416 free memory = 1598824840 SRR21853480 SRAfilesize 7e647009cbe405e8c243efc3bb835005 SRR21853480.sra SRR21853480.sra file validated SRR21853480 is single end SRR21853480 is conventional basespace SRR21853480 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.899 37.0 37.0 37.0 25.0 37.0 2 34.65 37.0 37.0 37.0 25.0 37.0 3 35.409 37.0 37.0 37.0 37.0 37.0 4 35.672 37.0 37.0 37.0 37.0 37.0 5 35.586 37.0 37.0 37.0 37.0 37.0 6 35.639 37.0 37.0 37.0 37.0 37.0 7 35.5335 37.0 37.0 37.0 37.0 37.0 8 35.8045 37.0 37.0 37.0 37.0 37.0 9 35.7285 37.0 37.0 37.0 37.0 37.0 10-11 35.76825 37.0 37.0 37.0 37.0 37.0 12-13 35.82225 37.0 37.0 37.0 37.0 37.0 14-15 35.7085 37.0 37.0 37.0 37.0 37.0 16-17 35.85975 37.0 37.0 37.0 37.0 37.0 18-19 35.80075 37.0 37.0 37.0 37.0 37.0 20-21 35.814750000000004 37.0 37.0 37.0 37.0 37.0 22-23 35.797 37.0 37.0 37.0 37.0 37.0 24-25 35.72675 37.0 37.0 37.0 37.0 37.0 26-27 35.650499999999994 37.0 37.0 37.0 37.0 37.0 28-29 35.716750000000005 37.0 37.0 37.0 37.0 37.0 30-31 35.594 37.0 37.0 37.0 37.0 37.0 32-33 35.483000000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.6755 37.0 37.0 37.0 37.0 37.0 36-37 35.583937953465096 37.0 37.0 37.0 37.0 37.0 38-39 35.678508881661244 37.0 37.0 37.0 37.0 37.0 40-41 35.55016262196648 37.0 37.0 37.0 37.0 37.0 42-43 35.45607008760951 37.0 37.0 37.0 37.0 37.0 44-45 35.27409261576972 37.0 37.0 37.0 31.0 37.0 46-47 35.40650813516896 37.0 37.0 37.0 37.0 37.0 48-49 35.41201501877347 37.0 37.0 37.0 37.0 37.0 50-51 35.56638276553106 37.0 37.0 37.0 37.0 37.0 52-53 35.41508016032064 37.0 37.0 37.0 37.0 37.0 54-55 35.421640575061424 37.0 37.0 37.0 37.0 37.0 56-57 35.32851886669819 37.0 37.0 37.0 31.0 37.0 58-59 35.32610865176984 37.0 37.0 37.0 31.0 37.0 60-61 35.42051153460381 37.0 37.0 37.0 37.0 37.0 62-63 35.1191073219659 37.0 37.0 37.0 25.0 37.0 64-65 35.29388164493481 37.0 37.0 37.0 37.0 37.0 66-67 35.0870110330993 37.0 37.0 37.0 25.0 37.0 68-69 34.896889111891625 37.0 37.0 37.0 25.0 37.0 70-71 34.816082575085574 37.0 37.0 37.0 25.0 37.0 72-73 35.0891287973889 37.0 37.0 37.0 25.0 37.0 74-75 35.29600803414512 37.0 37.0 37.0 37.0 37.0 76-77 35.27014812955059 37.0 37.0 37.0 37.0 37.0 78-79 35.167754897036666 37.0 37.0 37.0 25.0 37.0 80-81 35.288548468106484 37.0 37.0 37.0 37.0 37.0 82-83 35.29515197186636 37.0 37.0 37.0 31.0 37.0 84-85 35.208741522230596 37.0 37.0 37.0 25.0 37.0 86-87 35.25100502512563 37.0 37.0 37.0 31.0 37.0 88-89 35.13545188874758 37.0 37.0 37.0 25.0 37.0 90-91 35.30950489194214 37.0 37.0 37.0 31.0 37.0 92-93 35.19974842767296 37.0 37.0 37.0 25.0 37.0 94-95 35.22652895887721 37.0 37.0 37.0 25.0 37.0 96-97 35.13993432445808 37.0 37.0 37.0 25.0 37.0 98-99 35.27340441360542 37.0 37.0 37.0 37.0 37.0 100-101 35.02147941523958 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 0.0 23 4.0 24 12.0 25 6.0 26 18.0 27 30.0 28 35.0 29 51.0 30 70.0 31 109.0 32 165.0 33 202.0 34 308.0 35 534.0 36 2025.0 37 427.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.91445722861431 17.45872936468234 14.882441220610303 38.744372186093045 2 26.43939393939394 20.404040404040405 23.964646464646464 29.19191919191919 3 27.188594297148573 18.63431715857929 22.611305652826413 31.56578289144572 4 28.08904452226113 20.36018009004502 18.75937968984492 32.79139569784893 5 33.11655827913957 21.91095547773887 20.110055027513756 24.862431215607803 6 28.36418209104552 29.61480740370185 20.01000500250125 22.011005502751377 7 22.236118059029515 25.362681340670335 31.51575787893947 20.885442721360683 8 22.63631815907954 27.163581790895446 24.012006003001503 26.18809404702351 9 23.23661830915458 22.736368184092047 27.988994497248626 26.038019009504755 10-11 26.350675337668832 29.164582291145575 21.07303651825913 23.411705852926463 12-13 24.474737368684345 25.125062531265634 23.81190595297649 26.588294147073537 14-15 24.337168584292147 24.987493746873437 24.462231115557778 26.21310655327664 16-17 25.57528764382191 22.886443221610804 24.262131065532767 27.276138069034516 18-19 24.662331165582792 23.78689344672336 25.012506253126567 26.538269134567283 20-21 26.513256628314156 23.88694347173587 24.899949974987493 24.69984992496248 22-23 24.362181090545274 25.962981490745374 23.12406203101551 26.550775387693847 24-25 23.74937468734367 25.012506253126567 24.84992496248124 26.388194097048522 26-27 23.71185592796398 24.69984992496248 23.024012006003 28.564282141070535 28-29 26.138069034517258 25.100050025012504 23.649324662331164 25.11255627813907 30-31 24.312156078039017 24.487243621810904 25.41270635317659 25.78789394697349 32-33 24.449724862431214 25.65032516258129 23.036518259129565 26.863431715857928 34-35 25.68784392196098 24.874937468734366 23.699349674837418 25.737868934467233 36-37 25.006254691018263 25.606705028771582 24.25569176882662 25.13134851138354 38-39 24.530898173630224 24.668501376032022 25.94445834375782 24.856142106579934 40-41 23.592694520890667 23.792844633475106 24.11808856642482 28.49637227920941 42-43 24.680851063829788 25.256570713391742 24.63078848560701 25.431789737171464 44-45 24.943679599499376 25.056320400500624 23.829787234042556 26.170212765957444 46-47 26.795994993742177 24.680851063829788 22.941176470588236 25.5819774718398 48-49 24.192740926157697 24.868585732165208 25.844806007509387 25.093867334167708 50-51 25.663827655310623 23.659819639278556 25.0501002004008 25.626252505010022 52-53 25.80160320641283 22.833166332665332 23.885270541082164 27.47995991983968 54-55 25.579356131780035 23.55004384316673 24.276587748966556 26.59401227608668 56-57 25.23493296579376 24.15737376268638 24.671093847888738 25.936599423631122 58-59 24.066182000501378 24.354474805715718 24.266733517172224 27.312609676610677 60-61 25.514042126379138 24.49849548645938 24.648946840521564 25.33851554663992 62-63 25.012537612838514 24.159979939819458 24.586258776328986 26.241223671013035 64-65 25.664493480441326 24.786860581745234 24.285356068204614 25.263289869608823 66-67 24.711634904714142 26.49197592778335 23.156970912738213 25.63941825476429 68-69 24.94982438534872 26.24184646261917 23.394380331159056 25.413948820873056 70-71 25.981683603061096 24.275498682724876 23.309496926358047 26.43332078785598 72-73 26.58799899573186 23.374340949033392 24.47903590258599 25.558624152648758 74-75 27.152899824253073 23.123273914135073 24.077328646748683 25.64649761486317 76-77 25.784584484057245 23.38689430077831 25.069043434597038 25.759477780567412 78-79 27.373179306880964 23.254645906579608 23.01607232546459 26.356102461074837 80-81 27.310396785534905 24.183827222501257 23.2420894023104 25.26368658965344 82-83 26.978146194423513 23.888470233609645 23.31072594825421 25.822657623712637 84-85 27.7945239889475 23.474001507159006 23.348404923386084 25.38306958050741 86-87 27.27386934673367 24.15829145728643 23.743718592964825 24.824120603015075 88-89 27.729614273149895 23.131046613896217 23.633622314361098 25.505716798592786 90-91 26.51162790697674 24.274041483343808 24.07291011942175 25.141420490257698 92-93 27.584905660377355 24.28930817610063 23.10691823899371 25.018867924528305 94-95 28.907626478731434 23.382834130380065 23.206644852756103 24.502894538132395 96-97 27.00113450144964 23.63544686751544 24.227908735661163 25.135509895373755 98-99 27.714541501470773 22.944110500063946 24.51720168819542 24.824146310269857 100-101 28.911296675594766 9.988971167480699 30.04569087757996 31.054041279344574 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 1.5 28 3.5 29 7.0 30 7.5 31 8.0 32 13.0 33 20.0 34 24.5 35 30.5 36 35.5 37 52.0 38 69.0 39 85.5 40 115.5 41 135.5 42 156.5 43 176.0 44 164.5 45 160.0 46 179.5 47 182.5 48 167.0 49 150.5 50 142.0 51 131.5 52 111.5 53 98.5 54 94.0 55 87.5 56 77.0 57 76.5 58 72.5 59 66.5 60 75.5 61 70.0 62 63.5 63 73.0 64 73.5 65 88.0 66 101.5 67 78.5 68 59.0 69 62.0 70 67.0 71 57.5 72 48.5 73 45.5 74 35.0 75 26.5 76 21.5 77 13.0 78 9.5 79 9.0 80 7.5 81 6.0 82 4.5 83 3.5 84 2.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 1.0 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.05 24-25 0.05 26-27 0.05 28-29 0.05 30-31 0.05 32-33 0.05 34-35 0.05 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 3.0 36-37 0.0 38-39 0.0 40-41 2.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 3.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 1.0 58-59 2.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 2.0 68-69 0.0 70-71 3.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 1.0 82-83 0.0 84-85 1.0 86-87 0.0 88-89 2.0 90-91 3.0 92-93 1.0 94-95 3.0 96-97 33.0 98-99 317.0 100-101 3621.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 93.30418147034709 85.35000000000001 2 5.985241869363215 10.95 3 0.6285870456408855 1.725 4 0.027329871549603715 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027329871549603715 0.475 >50 0.027329871549603715 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 56 1.4000000000000001 TruSeq Adapter, Index 7 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCGCGTAT 19 0.475 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612694 spots for SRR21853480.sra Written 612694 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra Read 612691 spots for SRR21853480.sra Written 612691 spots for SRR21853480.sra SRR ids: ['SRR21853480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1_cm8ly SRR21853480.sra spots: 12253823 blocks: [[1, 612691], [612692, 1225382], [1225383, 1838073], [1838074, 2450764], [2450765, 3063455], [3063456, 3676146], [3676147, 4288837], [4288838, 4901528], [4901529, 5514219], [5514220, 6126910], [6126911, 6739601], [6739602, 7352292], [7352293, 7964983], [7964984, 8577674], [8577675, 9190365], [9190366, 9803056], [9803057, 10415747], [10415748, 11028438], [11028439, 11641129], [11641130, 12253823]] SRR21853480 file size 3293261 SRR21853480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853480 SRR21853480_1.fastq Input file: SRR21853480_1.fastq trimmed: SRR21853480-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:50:26 2024 >> started Fri Dec 6 15:50:33 2024 >> done (6.331s) 12253823 reads processed; of these: 55 ( 0.00%) short reads filtered out after trimming by size control 259035 ( 2.11%) empty reads filtered out after trimming by size control 11994733 (97.89%) reads available; of these: 637 ( 0.01%) trimmed reads available after processing 11994096 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 6 0.00% 21 2 0.00% 22 6 0.00% 23 7 0.00% 24 2 0.00% 25 6 0.00% 26 3 0.00% 27 1 0.00% 28 5 0.00% 29 9 0.00% 30 6 0.00% 31 7 0.00% 32 8 0.00% 33 9 0.00% 34 8 0.00% 35 308 0.00% 36 377 0.00% 37 343 0.00% 38 351 0.00% 39 341 0.00% 40 357 0.00% 41 401 0.00% 42 406 0.00% 43 406 0.00% 44 387 0.00% 45 408 0.00% 46 383 0.00% 47 436 0.00% 48 415 0.00% 49 552 0.00% 50 483 0.00% 51 484 0.00% 52 439 0.00% 53 520 0.00% 54 482 0.00% 55 566 0.00% 56 575 0.00% 57 572 0.00% 58 644 0.01% 59 689 0.01% 60 792 0.01% 61 1038 0.01% 62 813 0.01% 63 873 0.01% 64 843 0.01% 65 785 0.01% 66 920 0.01% 67 999 0.01% 68 958 0.01% 69 1108 0.01% 70 1115 0.01% 71 1236 0.01% 72 1275 0.01% 73 1287 0.01% 74 1407 0.01% 75 1370 0.01% 76 1354 0.01% 77 1413 0.01% 78 1542 0.01% 79 1679 0.01% 80 1786 0.01% 81 1800 0.02% 82 1953 0.02% 83 2019 0.02% 84 2266 0.02% 85 2237 0.02% 86 2249 0.02% 87 2239 0.02% 88 2421 0.02% 89 2581 0.02% 90 2748 0.02% 91 3331 0.03% 92 3119 0.03% 93 3512 0.03% 94 4069 0.03% 95 6509 0.05% 96 21672 0.18% 97 58369 0.49% 98 221730 1.85% 99 799420 6.66% 100 2649537 22.09% 101 8164936 68.07% 11994733 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=27 prefix-density=0.23 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=243.55 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=24.2 sequence=GCCGCCGCCACCCT Started job on | Dec 06 15:50:47 Started mapping on | Dec 06 15:50:47 Finished on | Dec 06 15:51:09 Mapping speed, Million of reads per hour | 1962.77 Number of input reads | 11994733 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11552416 Uniquely mapped reads % | 96.31% Average mapped length | 100.05 Number of splices: Total | 4010398 Number of splices: Annotated (sjdb) | 3811322 Number of splices: GT/AG | 3952088 Number of splices: GC/AG | 48940 Number of splices: AT/AC | 2057 Number of splices: Non-canonical | 7313 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 195519 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 54909 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 246798 246798 246798 N_multimapping 195519 195519 195519 N_noFeature 489602 5770704 6117531 N_ambiguous 177799 13851 11498 UnstrandedReadsAssigned:10885015 PositiveStrandReadsAssigned:5767861 NegativeStrandReadsAssigned:5423387 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853480 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853480-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,994,733 reads, 11,134,544 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR21853480.ke.tsv 35125 SRR21853480.se.tsv 88098 total ==> SRR21853480.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 35.6657 5.76992 PNS24249 1928 1829 110.502 9.23646 PNS24246 1044 945 35.6657 5.76992 PNS24248 1044 945 35.6657 5.76992 PNS24244 1471 1372 15.5012 1.72727 PNS24243 293 194 3 2.36412 KQK14069 1603 1504 5731.5 582.601 KQK14071 474 375 1122.27 457.528 ==> SRR21853480.se.tsv <== BRADI_1g14170v3 7833 BRADI_1g53295v3 35 BRADI_1g59795v3 348 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 1178 BRADI_1g74790v3 42 BRADI_1g09890v3 2 BRADI_1g77505v3 211 BRADI_1g48960v3 0 SRR21853480 completed mapping pipeline successfully