Starting /dee2/code/volunteer_pipeline.sh SRR21853481 current disk space = 1550405140480 free memory = 1375444312 SRR21853481 SRAfilesize 0f7259dbee389ceddfc158fb10e04a65 SRR21853481.sra SRR21853481.sra file validated SRR21853481 is single end SRR21853481 is conventional basespace SRR21853481 read1 length is 70-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 70-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.82 37.0 37.0 37.0 25.0 37.0 2 34.58875 37.0 37.0 37.0 25.0 37.0 3 35.572 37.0 37.0 37.0 37.0 37.0 4 35.662 37.0 37.0 37.0 37.0 37.0 5 35.745 37.0 37.0 37.0 37.0 37.0 6 35.65 37.0 37.0 37.0 37.0 37.0 7 35.545 37.0 37.0 37.0 37.0 37.0 8 35.7025 37.0 37.0 37.0 37.0 37.0 9 35.8015 37.0 37.0 37.0 37.0 37.0 10-11 35.781 37.0 37.0 37.0 37.0 37.0 12-13 35.8255 37.0 37.0 37.0 37.0 37.0 14-15 35.756249999999994 37.0 37.0 37.0 37.0 37.0 16-17 35.67575 37.0 37.0 37.0 37.0 37.0 18-19 35.650999999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.769 37.0 37.0 37.0 37.0 37.0 22-23 35.619 37.0 37.0 37.0 37.0 37.0 24-25 35.59375 37.0 37.0 37.0 37.0 37.0 26-27 35.56325 37.0 37.0 37.0 37.0 37.0 28-29 35.48175 37.0 37.0 37.0 37.0 37.0 30-31 35.51075 37.0 37.0 37.0 37.0 37.0 32-33 35.4315 37.0 37.0 37.0 37.0 37.0 34-35 35.3725 37.0 37.0 37.0 37.0 37.0 36-37 35.479749999999996 37.0 37.0 37.0 37.0 37.0 38-39 35.513000000000005 37.0 37.0 37.0 37.0 37.0 40-41 35.405 37.0 37.0 37.0 37.0 37.0 42-43 35.40025 37.0 37.0 37.0 37.0 37.0 44-45 35.4165 37.0 37.0 37.0 37.0 37.0 46-47 35.19575 37.0 37.0 37.0 25.0 37.0 48-49 35.40925 37.0 37.0 37.0 37.0 37.0 50-51 35.3665 37.0 37.0 37.0 37.0 37.0 52-53 35.322 37.0 37.0 37.0 31.0 37.0 54-55 35.401250000000005 37.0 37.0 37.0 37.0 37.0 56-57 35.354 37.0 37.0 37.0 37.0 37.0 58-59 35.41325 37.0 37.0 37.0 37.0 37.0 60-61 35.3865 37.0 37.0 37.0 37.0 37.0 62-63 35.24625 37.0 37.0 37.0 31.0 37.0 64-65 35.15825 37.0 37.0 37.0 25.0 37.0 66-67 35.411249999999995 37.0 37.0 37.0 37.0 37.0 68-69 35.171499999999995 37.0 37.0 37.0 31.0 37.0 70-71 35.205769379844966 37.0 37.0 37.0 31.0 37.0 72-73 35.190797699424856 37.0 37.0 37.0 25.0 37.0 74-75 35.189797449362345 37.0 37.0 37.0 25.0 37.0 76-77 34.99549887471868 37.0 37.0 37.0 25.0 37.0 78-79 35.091022755688925 37.0 37.0 37.0 25.0 37.0 80-81 35.15403850962741 37.0 37.0 37.0 25.0 37.0 82-83 35.28461279902267 37.0 37.0 37.0 31.0 37.0 84-85 34.998499249624814 37.0 37.0 37.0 25.0 37.0 86-87 35.19984992496248 37.0 37.0 37.0 25.0 37.0 88-89 35.10830415207604 37.0 37.0 37.0 25.0 37.0 90-91 35.1528264132066 37.0 37.0 37.0 31.0 37.0 92-93 35.035517758879436 37.0 37.0 37.0 25.0 37.0 94-95 35.09979989994997 37.0 37.0 37.0 25.0 37.0 96-97 35.11216721558876 37.0 37.0 37.0 25.0 37.0 98-99 35.06634424804091 37.0 37.0 37.0 25.0 37.0 100-101 35.179210740929946 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 1.0 24 7.0 25 14.0 26 18.0 27 23.0 28 44.0 29 56.0 30 97.0 31 122.0 32 139.0 33 205.0 34 298.0 35 556.0 36 1987.0 37 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.425 13.325000000000001 16.875 40.375 2 24.726810673443456 19.796696315120712 31.181702668360867 24.29479034307497 3 26.950000000000003 23.674999999999997 22.95 26.424999999999997 4 28.449999999999996 27.575 18.725 25.25 5 28.349999999999998 28.825 19.975 22.85 6 21.8 32.675 19.775000000000002 25.75 7 19.650000000000002 16.625 38.125 25.6 8 23.474999999999998 20.974999999999998 24.099999999999998 31.45 9 22.975 19.75 27.950000000000003 29.325000000000003 10-11 25.4875 26.674999999999997 19.9625 27.875 12-13 24.099999999999998 21.0 25.75 29.15 14-15 24.8 22.375 25.112499999999997 27.712500000000002 16-17 25.5125 23.2875 23.3 27.900000000000002 18-19 25.474999999999998 23.6375 23.075000000000003 27.8125 20-21 25.424999999999997 23.7875 23.5375 27.250000000000004 22-23 24.85 23.6125 23.3875 28.15 24-25 25.224999999999998 24.637500000000003 23.8375 26.3 26-27 25.45 24.775 23.0 26.775 28-29 25.587500000000002 24.4875 22.662499999999998 27.2625 30-31 24.9 24.087500000000002 24.325 26.687499999999996 32-33 25.837500000000002 24.0125 24.0625 26.087500000000002 34-35 26.087500000000002 24.45 22.825 26.637499999999996 36-37 25.3125 23.9375 23.9125 26.8375 38-39 25.662499999999998 24.2375 23.2875 26.8125 40-41 26.3625 24.0375 22.825 26.775 42-43 25.6 23.275000000000002 24.1375 26.987499999999997 44-45 26.0125 24.525 23.400000000000002 26.0625 46-47 26.087500000000002 23.6125 24.3125 25.9875 48-49 25.424999999999997 23.150000000000002 24.45 26.974999999999998 50-51 26.05 23.5375 23.425 26.987499999999997 52-53 25.387500000000003 24.6125 23.2375 26.7625 54-55 25.4 23.125 23.325000000000003 28.15 56-57 25.624999999999996 23.1875 24.25 26.937499999999996 58-59 25.587500000000002 23.3125 23.4625 27.6375 60-61 26.275 22.875 23.3625 27.487499999999997 62-63 26.05 24.0125 22.25 27.6875 64-65 25.424999999999997 23.2125 24.3 27.0625 66-67 25.5375 23.275000000000002 23.599999999999998 27.5875 68-69 26.2125 24.1375 23.2375 26.4125 70-71 25.315664458057256 23.8404800600075 22.352794099262407 28.491061382672832 72-73 25.64391097774444 24.043510877719427 23.118279569892472 27.19429857464366 74-75 26.36909227306827 23.40585146286572 22.218054513628406 28.00700175043761 76-77 26.131532883220803 23.768442110527634 21.75543885971493 28.34458614653663 78-79 26.106526631657918 24.268567141785446 22.680670167541887 26.944236059014752 80-81 25.481370342585645 23.705926481620406 23.643410852713178 27.169292323080768 82-83 25.672127047642867 23.558834562961113 23.108665749656122 27.660372639739904 84-85 26.23811905952976 23.19909954977489 23.224112056028016 27.33866933466733 86-87 26.063031515757878 23.58679339669835 23.21160580290145 27.138569284642323 88-89 25.012506253126567 23.23661830915458 24.224612306153077 27.52626313156578 90-91 25.900450225112557 23.774387193596798 23.47423711855928 26.850925462731368 92-93 26.513256628314156 24.12456228114057 23.66183091545773 25.700350175087543 94-95 26.40070035017509 23.74937468734367 22.52376188094047 27.326163081540773 96-97 27.105493680390442 22.77562257539732 22.375172068577147 27.74371167563509 98-99 27.205882352941174 22.52789046653144 23.69421906693712 26.57200811359026 100-101 26.13333333333333 10.007843137254902 28.95686274509804 34.90196078431372 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 3.5 29 5.5 30 8.0 31 8.5 32 9.0 33 16.0 34 23.0 35 31.5 36 44.5 37 57.5 38 63.5 39 77.0 40 90.5 41 101.0 42 118.0 43 132.5 44 146.5 45 153.0 46 157.5 47 154.5 48 135.0 49 129.5 50 133.5 51 130.5 52 126.5 53 116.5 54 106.5 55 92.5 56 93.0 57 96.5 58 96.0 59 100.5 60 88.0 61 89.0 62 95.5 63 86.0 64 91.0 65 95.0 66 91.0 67 81.0 68 70.0 69 72.0 70 62.5 71 53.0 72 49.5 73 44.0 74 42.5 75 37.0 76 29.0 77 19.5 78 13.5 79 10.0 80 6.5 81 5.0 82 3.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.625 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 5.0 97 11.0 98 76.0 99 262.0 100 913.0 101 2731.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.47593582887701 87.4 2 6.176470588235294 11.55 3 0.32085561497326204 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.026737967914438502 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.05 0.0 44-45 0.0 0.0 0.0 0.05 0.0 46-47 0.0 0.0 0.0 0.05 0.0 48-49 0.0 0.0 0.0 0.05 0.0 50-51 0.0 0.0 0.0 0.05 0.0 52-53 0.0 0.0 0.0 0.05 0.0 54-55 0.0 0.0 0.0 0.05 0.0 56-57 0.0 0.0 0.0 0.05 0.0 58-59 0.0 0.0 0.0 0.05 0.0 60-61 0.0 0.0 0.0 0.05 0.0 62-63 0.0 0.0 0.0 0.05 0.0 64-65 0.0 0.0 0.0 0.05 0.0 66-67 0.0 0.0 0.0 0.05 0.0 68-69 0.0 0.0 0.0 0.05 0.0 70-71 0.0 0.0 0.0 0.05 0.0 72-73 0.0 0.0 0.0 0.05 0.0 74-75 0.0 0.0 0.0 0.05 0.0 76-77 0.0 0.0 0.0 0.05 0.0 78-79 0.0 0.0 0.0 0.05 0.0 80-81 0.0 0.0 0.0 0.05 0.0 82-83 0.0 0.0 0.0 0.05 0.0 84-85 0.0 0.0 0.0 0.05 0.0 86-87 0.0 0.0 0.0 0.05 0.0 88-89 0.0 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978697 spots for SRR21853481.sra Written 978697 spots for SRR21853481.sra Read 978716 spots for SRR21853481.sra Written 978716 spots for SRR21853481.sra SRR ids: ['SRR21853481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1rdzwrjh SRR21853481.sra spots: 19573959 blocks: [[1, 978697], [978698, 1957394], [1957395, 2936091], [2936092, 3914788], [3914789, 4893485], [4893486, 5872182], [5872183, 6850879], [6850880, 7829576], [7829577, 8808273], [8808274, 9786970], [9786971, 10765667], [10765668, 11744364], [11744365, 12723061], [12723062, 13701758], [13701759, 14680455], [14680456, 15659152], [15659153, 16637849], [16637850, 17616546], [17616547, 18595243], [18595244, 19573959]] SRR21853481 file size 5273975 SRR21853481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853481 SRR21853481_1.fastq Input file: SRR21853481_1.fastq trimmed: SRR21853481-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:51:35 2024 >> started Fri Dec 6 15:51:50 2024 >> done (14.694s) 19573959 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 60031 ( 0.31%) empty reads filtered out after trimming by size control 19513918 (99.69%) reads available; of these: 439 ( 0.00%) trimmed reads available after processing 19513479 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 3 0.00% 24 6 0.00% 25 4 0.00% 26 2 0.00% 27 3 0.00% 28 13 0.00% 29 9 0.00% 30 4 0.00% 31 5 0.00% 32 3 0.00% 33 6 0.00% 34 6 0.00% 35 66 0.00% 36 83 0.00% 37 90 0.00% 38 96 0.00% 39 96 0.00% 40 101 0.00% 41 97 0.00% 42 110 0.00% 43 108 0.00% 44 98 0.00% 45 112 0.00% 46 115 0.00% 47 118 0.00% 48 117 0.00% 49 148 0.00% 50 131 0.00% 51 118 0.00% 52 131 0.00% 53 116 0.00% 54 146 0.00% 55 135 0.00% 56 139 0.00% 57 166 0.00% 58 156 0.00% 59 169 0.00% 60 164 0.00% 61 193 0.00% 62 188 0.00% 63 196 0.00% 64 174 0.00% 65 153 0.00% 66 173 0.00% 67 174 0.00% 68 193 0.00% 69 195 0.00% 70 210 0.00% 71 252 0.00% 72 211 0.00% 73 206 0.00% 74 229 0.00% 75 202 0.00% 76 226 0.00% 77 242 0.00% 78 273 0.00% 79 294 0.00% 80 265 0.00% 81 273 0.00% 82 270 0.00% 83 290 0.00% 84 318 0.00% 85 350 0.00% 86 320 0.00% 87 385 0.00% 88 382 0.00% 89 378 0.00% 90 501 0.00% 91 1095 0.01% 92 491 0.00% 93 706 0.00% 94 1440 0.01% 95 5179 0.03% 96 27814 0.14% 97 84865 0.43% 98 335833 1.72% 99 1300328 6.66% 100 4260006 21.83% 101 13485247 69.11% 19513918 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=9.84 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=4.5 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG Started job on | Dec 06 15:52:16 Started mapping on | Dec 06 15:52:16 Finished on | Dec 06 15:52:50 Mapping speed, Million of reads per hour | 2066.18 Number of input reads | 19513918 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17898539 Uniquely mapped reads % | 91.72% Average mapped length | 100.23 Number of splices: Total | 5958960 Number of splices: Annotated (sjdb) | 5674972 Number of splices: GT/AG | 5875701 Number of splices: GC/AG | 69365 Number of splices: AT/AC | 3057 Number of splices: Non-canonical | 10837 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.30 Insertion rate per base | 0.00% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 672264 % of reads mapped to multiple loci | 3.45% Number of reads mapped to too many loci | 574197 % of reads mapped to too many loci | 2.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.39% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 943115 943115 943115 N_multimapping 672264 672264 672264 N_noFeature 608688 9126632 9140222 N_ambiguous 277542 22779 16109 UnstrandedReadsAssigned:17012309 PositiveStrandReadsAssigned:8749128 NegativeStrandReadsAssigned:8742208 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853481 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853481-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,513,918 reads, 17,553,264 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR21853481.ke.tsv 35125 SRR21853481.se.tsv 88098 total ==> SRR21853481.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 4.89843 0.525993 PNS24247 1044 945 44.3615 4.21912 PNS24249 1928 1829 144.295 7.09065 PNS24246 1044 945 44.3615 4.21912 PNS24248 1044 945 44.3615 4.21912 PNS24244 1471 1372 16.722 1.09542 PNS24243 293 194 10 4.63283 KQK14069 1603 1504 2074.37 123.961 KQK14071 474 375 267.864 64.1994 ==> SRR21853481.se.tsv <== BRADI_1g14170v3 2548 BRADI_1g53295v3 78 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 1530 BRADI_1g74790v3 137 BRADI_1g09890v3 12 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR21853481 completed mapping pipeline successfully