Starting /dee2/code/volunteer_pipeline.sh SRR21853482 current disk space = 1550433144832 free memory = 1597247356 SRR21853482 SRAfilesize 885ae7ba70da0e3ee9c6dbe9c18fd251 SRR21853482.sra SRR21853482.sra file validated SRR21853482 is single end SRR21853482 is conventional basespace SRR21853482 read1 length is 43-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.0445 37.0 37.0 37.0 25.0 37.0 2 34.6855 37.0 37.0 37.0 25.0 37.0 3 35.4355 37.0 37.0 37.0 37.0 37.0 4 35.7295 37.0 37.0 37.0 37.0 37.0 5 35.849 37.0 37.0 37.0 37.0 37.0 6 35.836 37.0 37.0 37.0 37.0 37.0 7 35.5775 37.0 37.0 37.0 37.0 37.0 8 35.6915 37.0 37.0 37.0 37.0 37.0 9 35.881 37.0 37.0 37.0 37.0 37.0 10-11 35.84525 37.0 37.0 37.0 37.0 37.0 12-13 35.87975 37.0 37.0 37.0 37.0 37.0 14-15 35.838 37.0 37.0 37.0 37.0 37.0 16-17 35.80575 37.0 37.0 37.0 37.0 37.0 18-19 35.819 37.0 37.0 37.0 37.0 37.0 20-21 35.846999999999994 37.0 37.0 37.0 37.0 37.0 22-23 35.863 37.0 37.0 37.0 37.0 37.0 24-25 35.82325 37.0 37.0 37.0 37.0 37.0 26-27 35.646 37.0 37.0 37.0 37.0 37.0 28-29 35.6815 37.0 37.0 37.0 37.0 37.0 30-31 35.61175 37.0 37.0 37.0 37.0 37.0 32-33 35.5715 37.0 37.0 37.0 37.0 37.0 34-35 35.552 37.0 37.0 37.0 37.0 37.0 36-37 35.574250000000006 37.0 37.0 37.0 37.0 37.0 38-39 35.5935 37.0 37.0 37.0 37.0 37.0 40-41 35.518 37.0 37.0 37.0 37.0 37.0 42-43 35.442499999999995 37.0 37.0 37.0 37.0 37.0 44-45 35.41660415103776 37.0 37.0 37.0 37.0 37.0 46-47 35.47711927981996 37.0 37.0 37.0 37.0 37.0 48-49 35.393598399599895 37.0 37.0 37.0 37.0 37.0 50-51 35.51087771942986 37.0 37.0 37.0 37.0 37.0 52-53 35.45036259064766 37.0 37.0 37.0 37.0 37.0 54-55 35.36884221055264 37.0 37.0 37.0 37.0 37.0 56-57 35.39409852463116 37.0 37.0 37.0 37.0 37.0 58-59 35.47911977994499 37.0 37.0 37.0 37.0 37.0 60-61 35.45036259064766 37.0 37.0 37.0 37.0 37.0 62-63 35.28157039259815 37.0 37.0 37.0 31.0 37.0 64-65 35.324581145286324 37.0 37.0 37.0 37.0 37.0 66-67 35.32883220805201 37.0 37.0 37.0 31.0 37.0 68-69 35.239309827456864 37.0 37.0 37.0 37.0 37.0 70-71 35.3028257064266 37.0 37.0 37.0 37.0 37.0 72-73 35.246811702925726 37.0 37.0 37.0 31.0 37.0 74-75 35.28407101775444 37.0 37.0 37.0 31.0 37.0 76-77 35.287393696848426 37.0 37.0 37.0 31.0 37.0 78-79 35.24743557668251 37.0 37.0 37.0 31.0 37.0 80-81 35.31948961721291 37.0 37.0 37.0 37.0 37.0 82-83 35.26069552164123 37.0 37.0 37.0 31.0 37.0 84-85 35.139868540043665 37.0 37.0 37.0 25.0 37.0 86-87 35.19094094094094 37.0 37.0 37.0 25.0 37.0 88-89 35.2525025025025 37.0 37.0 37.0 31.0 37.0 90-91 35.23373373373373 37.0 37.0 37.0 25.0 37.0 92-93 35.156406406406404 37.0 37.0 37.0 25.0 37.0 94-95 35.101351351351354 37.0 37.0 37.0 25.0 37.0 96-97 35.10866001271813 37.0 37.0 37.0 25.0 37.0 98-99 35.13730539749869 37.0 37.0 37.0 25.0 37.0 100-101 35.029680212562674 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 4.0 24 8.0 25 7.0 26 13.0 27 27.0 28 51.0 29 50.0 30 85.0 31 107.0 32 117.0 33 211.0 34 310.0 35 516.0 36 2064.0 37 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.849999999999998 12.6 18.125 40.425 2 26.154236428209032 19.431760527650937 29.401319127346525 25.012683916793506 3 26.650000000000002 22.175 23.125 28.050000000000004 4 27.875 27.925 18.05 26.150000000000002 5 30.775000000000002 29.099999999999998 18.7 21.425 6 22.35 32.1 19.45 26.1 7 20.925 14.05 38.025 27.0 8 23.1 21.575 23.35 31.974999999999998 9 22.075 20.150000000000002 28.775000000000002 28.999999999999996 10-11 27.462500000000002 26.724999999999998 18.987499999999997 26.825 12-13 24.325 21.2375 25.137500000000003 29.299999999999997 14-15 25.4875 23.200000000000003 24.2625 27.05 16-17 25.874999999999996 23.2875 22.275 28.5625 18-19 25.412499999999998 22.8875 23.325000000000003 28.375 20-21 25.7125 23.925 23.200000000000003 27.1625 22-23 26.6125 24.575 22.175 26.637499999999996 24-25 25.362499999999997 22.650000000000002 24.2875 27.700000000000003 26-27 25.900000000000002 23.3125 23.45 27.3375 28-29 26.7125 23.150000000000002 23.0125 27.125 30-31 25.337500000000002 23.724999999999998 23.925 27.0125 32-33 26.25 23.6625 22.725 27.3625 34-35 26.087500000000002 23.7875 22.900000000000002 27.224999999999998 36-37 25.1875 23.3875 24.2875 27.1375 38-39 25.9875 22.5875 24.025 27.400000000000002 40-41 25.85 23.6375 23.0 27.5125 42-43 25.4875 23.4375 23.925 27.150000000000002 44-45 26.331582895723933 23.55588897224306 22.693173293323333 27.419354838709676 46-47 26.056514128532132 22.53063265816454 23.643410852713178 27.769442360590148 48-49 25.418854713678417 23.393348337084273 23.393348337084273 27.79444861215304 50-51 26.581645411352838 23.80595148787197 23.69342335583896 25.918979744936234 52-53 26.619154788697173 22.74318579644911 22.95573893473368 27.68192048012003 54-55 25.406351587896975 23.893473368342086 23.280820205051263 27.419354838709676 56-57 26.38159539884971 23.143285821455365 22.343085771442862 28.132033008252062 58-59 26.431607901975497 23.330832708177045 23.218304576144035 27.019254813703427 60-61 26.469117279319832 24.10602650662666 22.655663915978995 26.76919229807452 62-63 25.743935983995996 23.643410852713178 24.01850462615654 26.59414853713428 64-65 25.693923480870218 23.030757689422355 23.705926481620406 27.569392348087025 66-67 26.556639159789945 23.643410852713178 21.94298574643661 27.85696424106027 68-69 25.593898474618655 24.10602650662666 23.468367091772944 26.831707926981746 70-71 25.49387346836709 23.168292073018254 23.80595148787197 27.53188297074269 72-73 26.86921730432608 22.85571392848212 22.48062015503876 27.79444861215304 74-75 26.994248562140534 23.20580145036259 23.305826456614152 26.494123530882717 76-77 26.575787893946973 22.498749374687343 23.88694347173587 27.03851925962982 78-79 26.51988991743808 22.692019014260694 23.317488116087066 27.47060295221416 80-81 26.044533400050035 24.180635476607456 22.329246935201404 27.445584188141105 82-83 26.419814861145856 22.679509632224168 23.705278959219413 27.195396547410557 84-85 27.461528837733017 22.757412736144126 22.982609783560616 26.79844864256224 86-87 26.83933933933934 23.44844844844845 22.885385385385383 26.826826826826828 88-89 26.564064064064063 23.21071071071071 23.373373373373376 26.851851851851855 90-91 25.375375375375377 23.323323323323322 23.14814814814815 28.153153153153156 92-93 26.238738738738736 23.285785785785787 23.085585585585587 27.38988988988989 94-95 27.13963963963964 22.7977977977978 22.922922922922922 27.13963963963964 96-97 27.353530295443164 23.372558838257387 23.04707060590886 26.22684026039059 98-99 26.977275612542844 22.343531801447252 23.194109432525075 27.48508315348483 100-101 28.68826675055049 9.908776344762504 27.461465869770368 33.941491034916645 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 3.5 27 4.0 28 4.0 29 6.0 30 5.5 31 8.5 32 12.5 33 13.5 34 18.0 35 25.0 36 36.5 37 47.5 38 56.0 39 66.0 40 92.5 41 117.5 42 131.0 43 141.0 44 144.5 45 136.0 46 126.5 47 136.5 48 145.0 49 138.5 50 132.5 51 116.5 52 110.5 53 106.0 54 94.0 55 107.0 56 108.5 57 91.0 58 85.5 59 82.0 60 84.0 61 94.5 62 94.0 63 87.5 64 87.0 65 94.0 66 95.0 67 95.0 68 97.0 69 87.5 70 70.5 71 62.5 72 64.0 73 59.0 74 45.5 75 39.5 76 30.5 77 22.0 78 17.5 79 9.5 80 4.5 81 3.0 82 2.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.4500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 1.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 1.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 23.0 98-99 352.0 100-101 3621.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.34049409237379 86.9 2 6.229860365198711 11.600000000000001 3 0.322234156820623 0.8999999999999999 4 0.02685284640171858 0.1 5 0.02685284640171858 0.125 6 0.0 0.0 7 0.02685284640171858 0.17500000000000002 8 0.02685284640171858 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCGCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 38bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 38bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra Read 1013619 spots for SRR21853482.sra Written 1013619 spots for SRR21853482.sra Read 1013615 spots for SRR21853482.sra Written 1013615 spots for SRR21853482.sra SRR ids: ['SRR21853482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3y8yelnc SRR21853482.sra spots: 20272304 blocks: [[1, 1013615], [1013616, 2027230], [2027231, 3040845], [3040846, 4054460], [4054461, 5068075], [5068076, 6081690], [6081691, 7095305], [7095306, 8108920], [8108921, 9122535], [9122536, 10136150], [10136151, 11149765], [11149766, 12163380], [12163381, 13176995], [13176996, 14190610], [14190611, 15204225], [15204226, 16217840], [16217841, 17231455], [17231456, 18245070], [18245071, 19258685], [19258686, 20272304]] SRR21853482 file size 5462744 SRR21853482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853482 SRR21853482_1.fastq Input file: SRR21853482_1.fastq trimmed: SRR21853482-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:55:29 2024 >> started Fri Dec 6 15:55:39 2024 >> done (10.063s) 20272304 reads processed; of these: 8 ( 0.00%) short reads filtered out after trimming by size control 75814 ( 0.37%) empty reads filtered out after trimming by size control 20196482 (99.63%) reads available; of these: 555 ( 0.00%) trimmed reads available after processing 20195927 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 5 0.00% 28 3 0.00% 29 7 0.00% 30 4 0.00% 31 6 0.00% 32 0 0.00% 33 6 0.00% 34 2 0.00% 35 69 0.00% 36 77 0.00% 37 65 0.00% 38 86 0.00% 39 94 0.00% 40 111 0.00% 41 96 0.00% 42 95 0.00% 43 97 0.00% 44 78 0.00% 45 99 0.00% 46 101 0.00% 47 122 0.00% 48 105 0.00% 49 104 0.00% 50 113 0.00% 51 115 0.00% 52 122 0.00% 53 116 0.00% 54 138 0.00% 55 136 0.00% 56 113 0.00% 57 153 0.00% 58 137 0.00% 59 154 0.00% 60 188 0.00% 61 1081 0.01% 62 177 0.00% 63 168 0.00% 64 152 0.00% 65 173 0.00% 66 184 0.00% 67 195 0.00% 68 189 0.00% 69 185 0.00% 70 196 0.00% 71 221 0.00% 72 194 0.00% 73 191 0.00% 74 206 0.00% 75 217 0.00% 76 208 0.00% 77 237 0.00% 78 288 0.00% 79 244 0.00% 80 310 0.00% 81 284 0.00% 82 242 0.00% 83 277 0.00% 84 323 0.00% 85 309 0.00% 86 363 0.00% 87 363 0.00% 88 406 0.00% 89 439 0.00% 90 497 0.00% 91 988 0.00% 92 514 0.00% 93 694 0.00% 94 1570 0.01% 95 5503 0.03% 96 28911 0.14% 97 85350 0.42% 98 341422 1.69% 99 1343870 6.65% 100 4331780 21.45% 101 14044426 69.54% 20196482 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=24 prefix-density=0.43 prefix-fanout=2.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=32 fanout-score=10.42 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.7 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG Started job on | Dec 06 15:55:58 Started mapping on | Dec 06 15:55:58 Finished on | Dec 06 15:56:22 Mapping speed, Million of reads per hour | 3029.47 Number of input reads | 20196482 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18817588 Uniquely mapped reads % | 93.17% Average mapped length | 100.24 Number of splices: Total | 6155361 Number of splices: Annotated (sjdb) | 5874090 Number of splices: GT/AG | 6067127 Number of splices: GC/AG | 73085 Number of splices: AT/AC | 2793 Number of splices: Non-canonical | 12356 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.00% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 600951 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 461113 % of reads mapped to too many loci | 2.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 777943 777943 777943 N_multimapping 600951 600951 600951 N_noFeature 578982 9566858 9578015 N_ambiguous 286609 20659 16156 UnstrandedReadsAssigned:17951997 PositiveStrandReadsAssigned:9230071 NegativeStrandReadsAssigned:9223417 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853482 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853482-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,196,482 reads, 18,489,330 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR21853482.ke.tsv 35125 SRR21853482.se.tsv 88098 total ==> SRR21853482.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 17.6134 1.78241 PNS24247 1044 945 30.4263 2.72714 PNS24249 1928 1829 171.993 7.96504 PNS24246 1044 945 30.4263 2.72714 PNS24248 1044 945 30.4263 2.72714 PNS24244 1471 1372 16.1146 0.994845 PNS24243 293 194 8 3.49284 KQK14069 1603 1504 1643.45 92.5549 KQK14071 474 375 294.077 66.4233 ==> SRR21853482.se.tsv <== BRADI_1g14170v3 2154 BRADI_1g53295v3 32 BRADI_1g59795v3 313 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 1802 BRADI_1g74790v3 110 BRADI_1g09890v3 10 BRADI_1g77505v3 215 BRADI_1g48960v3 0 SRR21853482 completed mapping pipeline successfully