Starting /dee2/code/volunteer_pipeline.sh SRR21853483 current disk space = 1550425550848 free memory = 1597240816 SRR21853483 SRAfilesize 45036f1518fca6988ed48a00b8ddb42b SRR21853483.sra SRR21853483.sra file validated SRR21853483 is single end SRR21853483 is conventional basespace SRR21853483 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.88775 37.0 37.0 37.0 25.0 37.0 2 34.55075 37.0 37.0 37.0 25.0 37.0 3 35.50375 37.0 37.0 37.0 37.0 37.0 4 35.51675 37.0 37.0 37.0 37.0 37.0 5 35.67475 37.0 37.0 37.0 37.0 37.0 6 35.73275 37.0 37.0 37.0 37.0 37.0 7 35.65125 37.0 37.0 37.0 37.0 37.0 8 35.81275 37.0 37.0 37.0 37.0 37.0 9 35.68675 37.0 37.0 37.0 37.0 37.0 10-11 35.869 37.0 37.0 37.0 37.0 37.0 12-13 35.835 37.0 37.0 37.0 37.0 37.0 14-15 35.775999999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.89225 37.0 37.0 37.0 37.0 37.0 18-19 35.79325 37.0 37.0 37.0 37.0 37.0 20-21 35.831 37.0 37.0 37.0 37.0 37.0 22-23 35.8445 37.0 37.0 37.0 37.0 37.0 24-25 35.6525 37.0 37.0 37.0 37.0 37.0 26-27 35.677499999999995 37.0 37.0 37.0 37.0 37.0 28-29 35.60525 37.0 37.0 37.0 37.0 37.0 30-31 35.639250000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.524249999999995 37.0 37.0 37.0 37.0 37.0 34-35 35.56275 37.0 37.0 37.0 37.0 37.0 36-37 35.59464866216554 37.0 37.0 37.0 37.0 37.0 38-39 35.632658164541134 37.0 37.0 37.0 37.0 37.0 40-41 35.59314828707177 37.0 37.0 37.0 37.0 37.0 42-43 35.53713428357089 37.0 37.0 37.0 37.0 37.0 44-45 35.395848962240564 37.0 37.0 37.0 37.0 37.0 46-47 35.48837209302326 37.0 37.0 37.0 37.0 37.0 48-49 35.52388097024256 37.0 37.0 37.0 37.0 37.0 50-51 35.535633908477124 37.0 37.0 37.0 37.0 37.0 52-53 35.50287571892973 37.0 37.0 37.0 37.0 37.0 54-55 35.50112528132033 37.0 37.0 37.0 37.0 37.0 56-57 35.37809452363091 37.0 37.0 37.0 37.0 37.0 58-59 35.60890222555639 37.0 37.0 37.0 37.0 37.0 60-61 35.56939234808702 37.0 37.0 37.0 37.0 37.0 62-63 35.35983995999 37.0 37.0 37.0 37.0 37.0 64-65 35.43660915228807 37.0 37.0 37.0 37.0 37.0 66-67 35.45911477869467 37.0 37.0 37.0 37.0 37.0 68-69 35.410352588147035 37.0 37.0 37.0 37.0 37.0 70-71 35.30432608152038 37.0 37.0 37.0 37.0 37.0 72-73 35.39284821205301 37.0 37.0 37.0 37.0 37.0 74-75 35.34058514628657 37.0 37.0 37.0 31.0 37.0 76-77 35.320830207551886 37.0 37.0 37.0 37.0 37.0 78-79 35.366591647911974 37.0 37.0 37.0 37.0 37.0 80-81 35.46511627906977 37.0 37.0 37.0 37.0 37.0 82-83 35.39234808702176 37.0 37.0 37.0 37.0 37.0 84-85 35.31357839459865 37.0 37.0 37.0 37.0 37.0 86-87 35.36259064766192 37.0 37.0 37.0 31.0 37.0 88-89 35.33883470867717 37.0 37.0 37.0 31.0 37.0 90-91 35.37834458614654 37.0 37.0 37.0 37.0 37.0 92-93 35.385096274068516 37.0 37.0 37.0 37.0 37.0 94-95 35.31462336569635 37.0 37.0 37.0 37.0 37.0 96-97 35.23831497464822 37.0 37.0 37.0 25.0 37.0 98-99 35.19727277291895 37.0 37.0 37.0 25.0 37.0 100-101 35.26499730108502 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 4.0 24 6.0 25 6.0 26 11.0 27 23.0 28 37.0 29 52.0 30 84.0 31 95.0 32 144.0 33 189.0 34 286.0 35 554.0 36 2064.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.582645661415352 12.028007001750437 16.379094773693424 41.01025256314079 2 26.426578747146845 19.75653056048694 27.82145574435709 25.995434948009127 3 27.33183295823956 24.031007751937985 19.529882470617654 29.107276819204802 4 29.332333083270818 26.881720430107524 16.829207301825456 26.9567391847962 5 29.982495623905976 26.70667666916729 19.05476369092273 24.256064016004 6 23.88097024256064 30.307576894223555 19.179794948737182 26.63165791447862 7 20.830207551887973 15.303825956489122 36.284071017754435 27.581895473868467 8 24.5311327831958 21.180295073768445 22.380595148787197 31.90797699424856 9 23.680920230057513 20.40510127531883 26.231557889472366 29.68242060515129 10-11 26.894223555888974 26.469117279319832 18.86721680420105 27.769442360590148 12-13 25.143785946486624 20.667666916729182 24.18104526131533 30.00750187546887 14-15 25.03125781445361 23.69342335583896 23.680920230057513 27.59439859964991 16-17 26.819204801200303 21.75543885971493 22.31807951987997 29.107276819204802 18-19 26.731682920730183 23.380845211302827 22.643160790197552 27.24431107776944 20-21 25.64391097774444 24.006001500375092 22.718179544886222 27.631907976994246 22-23 25.51887971992998 24.268567141785446 21.75543885971493 28.457114278569644 24-25 26.6816704176044 23.25581395348837 21.59289822455614 28.469617404351087 26-27 27.60690172543136 22.230557639409852 22.218054513628406 27.94448612153038 28-29 25.968992248062015 23.80595148787197 23.068267066766694 27.156789197299325 30-31 26.331582895723933 23.868467116779193 22.043010752688172 27.7569392348087 32-33 26.25656414103526 23.13078269567392 22.405601400350086 28.207051762940733 34-35 26.38159539884971 23.36834208552138 22.29307326831708 27.956989247311824 36-37 26.269067266816705 23.718429607401852 21.99299824956239 28.019504876219052 38-39 27.38184546136534 23.268317079269817 21.717929482370593 27.631907976994246 40-41 26.469117279319832 22.643160790197552 23.305826456614152 27.581895473868467 42-43 26.281570392598148 23.218304576144035 22.468117029257314 28.032008002000502 44-45 26.744186046511626 23.355838959739934 22.230557639409852 27.66941735433858 46-47 27.60690172543136 22.443110777694425 22.305576394098527 27.644411102775695 48-49 26.694173543385848 23.055763940985248 22.36809202300575 27.881970492623154 50-51 27.581895473868467 21.842960740185045 22.393098274568644 28.182045511377847 52-53 26.881720430107524 22.030507626906726 22.418104526131533 28.66966741685421 54-55 27.00675168792198 22.29307326831708 21.817954488622153 28.882220555138783 56-57 27.894473618404604 22.418104526131533 22.18054513628407 27.506876719179797 58-59 27.00675168792198 22.630657664416105 22.518129532383096 27.84446111527882 60-61 27.069267316829208 23.15578894723681 22.080520130032507 27.694423605901473 62-63 25.84396099024756 22.568142035508878 22.705676419104776 28.882220555138783 64-65 27.781945486371594 22.493123280820203 21.66791697924481 28.057014253563388 66-67 26.881720430107524 22.73068267066767 21.605401350337583 28.782195548887223 68-69 27.38184546136534 22.468117029257314 21.61790447611903 28.532133033258315 70-71 27.306826706676667 22.155538884721178 21.655413853463365 28.882220555138783 72-73 26.04401100275069 22.793198299574893 22.53063265816454 28.632158039509875 74-75 26.906726681670417 22.73068267066767 21.842960740185045 28.51962990747687 76-77 27.19429857464366 22.85571392848212 22.418104526131533 27.53188297074269 78-79 28.257064266066518 22.280570142535634 21.492873218304574 27.969492373093274 80-81 27.59439859964991 22.355588897224308 21.817954488622153 28.232058014503625 82-83 27.656914228557138 21.85546386596649 22.918229557389346 27.569392348087025 84-85 26.86921730432608 21.99299824956239 22.605651412853213 28.532133033258315 86-87 27.781945486371594 22.543135783945985 21.705426356589147 27.969492373093274 88-89 27.506876719179797 22.393098274568644 22.418104526131533 27.68192048012003 90-91 27.031757939484873 22.768192048012004 22.643160790197552 27.556889222305575 92-93 27.94448612153038 22.768192048012004 21.205301325331334 28.08202050512628 94-95 27.285231961985744 23.008628235588347 21.370513942728522 28.335625859697387 96-97 27.183979974968707 22.165206508135167 21.989987484355446 28.660826032540676 98-99 27.67494929006085 21.209432048681542 22.401115618661258 28.714503042596352 100-101 28.511301636788776 10.085736554949337 27.482462977396725 33.92049883086516 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.0 30 5.0 31 5.5 32 7.0 33 11.5 34 12.5 35 16.5 36 29.5 37 38.5 38 46.5 39 64.5 40 80.5 41 88.5 42 105.5 43 129.5 44 128.0 45 120.0 46 134.0 47 135.5 48 126.0 49 118.5 50 123.5 51 118.0 52 108.0 53 107.5 54 103.5 55 105.5 56 91.5 57 91.5 58 105.0 59 103.5 60 101.0 61 101.5 62 100.5 63 95.0 64 98.0 65 101.5 66 107.0 67 98.5 68 82.5 69 93.5 70 97.5 71 84.0 72 75.0 73 71.0 74 56.0 75 45.0 76 40.0 77 25.0 78 15.5 79 15.5 80 13.0 81 7.5 82 3.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.425 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 2.0 96-97 26.0 98-99 326.0 100-101 3645.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.88984648532185 86.225 2 6.6253703204955565 12.3 3 0.4578507945057905 1.275 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.026932399676811204 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 8 0.2 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra Read 922498 spots for SRR21853483.sra Written 922498 spots for SRR21853483.sra Read 922490 spots for SRR21853483.sra Written 922490 spots for SRR21853483.sra SRR ids: ['SRR21853483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fuv_gxhy SRR21853483.sra spots: 18449808 blocks: [[1, 922490], [922491, 1844980], [1844981, 2767470], [2767471, 3689960], [3689961, 4612450], [4612451, 5534940], [5534941, 6457430], [6457431, 7379920], [7379921, 8302410], [8302411, 9224900], [9224901, 10147390], [10147391, 11069880], [11069881, 11992370], [11992371, 12914860], [12914861, 13837350], [13837351, 14759840], [14759841, 15682330], [15682331, 16604820], [16604821, 17527310], [17527311, 18449808]] SRR21853483 file size 4971001 SRR21853483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853483 SRR21853483_1.fastq Input file: SRR21853483_1.fastq trimmed: SRR21853483-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:56:04 2024 >> started Fri Dec 6 15:56:14 2024 >> done (9.906s) 18449808 reads processed; of these: 13 ( 0.00%) short reads filtered out after trimming by size control 52897 ( 0.29%) empty reads filtered out after trimming by size control 18396898 (99.71%) reads available; of these: 390 ( 0.00%) trimmed reads available after processing 18396508 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 0 0.00% 27 2 0.00% 28 6 0.00% 29 3 0.00% 30 9 0.00% 31 5 0.00% 32 7 0.00% 33 5 0.00% 34 4 0.00% 35 66 0.00% 36 67 0.00% 37 88 0.00% 38 109 0.00% 39 81 0.00% 40 92 0.00% 41 118 0.00% 42 88 0.00% 43 83 0.00% 44 105 0.00% 45 97 0.00% 46 113 0.00% 47 123 0.00% 48 99 0.00% 49 102 0.00% 50 83 0.00% 51 105 0.00% 52 124 0.00% 53 127 0.00% 54 145 0.00% 55 135 0.00% 56 130 0.00% 57 123 0.00% 58 145 0.00% 59 137 0.00% 60 152 0.00% 61 178 0.00% 62 159 0.00% 63 169 0.00% 64 158 0.00% 65 161 0.00% 66 190 0.00% 67 177 0.00% 68 154 0.00% 69 179 0.00% 70 167 0.00% 71 193 0.00% 72 199 0.00% 73 183 0.00% 74 183 0.00% 75 221 0.00% 76 197 0.00% 77 228 0.00% 78 203 0.00% 79 237 0.00% 80 228 0.00% 81 249 0.00% 82 284 0.00% 83 280 0.00% 84 290 0.00% 85 267 0.00% 86 303 0.00% 87 326 0.00% 88 364 0.00% 89 367 0.00% 90 480 0.00% 91 883 0.00% 92 458 0.00% 93 540 0.00% 94 1398 0.01% 95 5213 0.03% 96 25997 0.14% 97 73919 0.40% 98 299427 1.63% 99 1208025 6.57% 100 3826913 20.80% 101 12944254 70.36% 18396898 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=25 prefix-density=0.53 prefix-fanout=1.7 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.16 sequence-density-rank=21 fanout-score=172.11 fanout-score-rank=1 prefix-density=1.21 prefix-fanout=22.5 sequence=GCCGCCGCCACCCTGA Started job on | Dec 06 15:56:32 Started mapping on | Dec 06 15:56:33 Finished on | Dec 06 15:57:02 Mapping speed, Million of reads per hour | 2283.75 Number of input reads | 18396898 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17233682 Uniquely mapped reads % | 93.68% Average mapped length | 100.27 Number of splices: Total | 5349531 Number of splices: Annotated (sjdb) | 5101469 Number of splices: GT/AG | 5275175 Number of splices: GC/AG | 62696 Number of splices: AT/AC | 2451 Number of splices: Non-canonical | 9209 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.34 Insertion rate per base | 0.00% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491553 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 409811 % of reads mapped to too many loci | 2.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671663 671663 671663 N_multimapping 491553 491553 491553 N_noFeature 471396 8762145 8712393 N_ambiguous 263436 20515 14041 UnstrandedReadsAssigned:16498850 PositiveStrandReadsAssigned:8451022 NegativeStrandReadsAssigned:8507248 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853483 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853483-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,396,898 reads, 16,929,891 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52973 SRR21853483.ke.tsv 35125 SRR21853483.se.tsv 88098 total ==> SRR21853483.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 72.2714 7.80859 PNS24247 1044 945 0 0 PNS24249 1928 1829 191.351 9.46123 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 13.378 0.881796 PNS24243 293 194 8 3.72924 KQK14069 1603 1504 1598.66 96.1258 KQK14071 474 375 257.959 62.2087 ==> SRR21853483.se.tsv <== BRADI_1g14170v3 2004 BRADI_1g53295v3 23 BRADI_1g59795v3 261 BRADI_1g07683v3 0 BRADI_1g00485v3 56 BRADI_1g20270v3 1745 BRADI_1g74790v3 112 BRADI_1g09890v3 8 BRADI_1g77505v3 181 BRADI_1g48960v3 1 SRR21853483 completed mapping pipeline successfully