Starting /dee2/code/volunteer_pipeline.sh SRR21853484 current disk space = 1550431793152 free memory = 1597229892 SRR21853484 SRAfilesize 7c4d4d2f448757ce09e75d50facbeb6a SRR21853484.sra SRR21853484.sra file validated SRR21853484 is single end SRR21853484 is conventional basespace SRR21853484 read1 length is 52-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.195 37.0 37.0 37.0 25.0 37.0 2 34.91125 37.0 37.0 37.0 25.0 37.0 3 35.6685 37.0 37.0 37.0 37.0 37.0 4 35.6015 37.0 37.0 37.0 37.0 37.0 5 35.816 37.0 37.0 37.0 37.0 37.0 6 35.886 37.0 37.0 37.0 37.0 37.0 7 35.53 37.0 37.0 37.0 37.0 37.0 8 35.869 37.0 37.0 37.0 37.0 37.0 9 35.8135 37.0 37.0 37.0 37.0 37.0 10-11 35.8225 37.0 37.0 37.0 37.0 37.0 12-13 35.891999999999996 37.0 37.0 37.0 37.0 37.0 14-15 35.880250000000004 37.0 37.0 37.0 37.0 37.0 16-17 35.895250000000004 37.0 37.0 37.0 37.0 37.0 18-19 35.73725 37.0 37.0 37.0 37.0 37.0 20-21 35.792249999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.7435 37.0 37.0 37.0 37.0 37.0 24-25 35.741749999999996 37.0 37.0 37.0 37.0 37.0 26-27 35.6245 37.0 37.0 37.0 37.0 37.0 28-29 35.68 37.0 37.0 37.0 37.0 37.0 30-31 35.5625 37.0 37.0 37.0 37.0 37.0 32-33 35.5705 37.0 37.0 37.0 37.0 37.0 34-35 35.543000000000006 37.0 37.0 37.0 37.0 37.0 36-37 35.5275 37.0 37.0 37.0 37.0 37.0 38-39 35.576499999999996 37.0 37.0 37.0 37.0 37.0 40-41 35.5095 37.0 37.0 37.0 37.0 37.0 42-43 35.58125 37.0 37.0 37.0 37.0 37.0 44-45 35.431 37.0 37.0 37.0 37.0 37.0 46-47 35.524249999999995 37.0 37.0 37.0 37.0 37.0 48-49 35.52675 37.0 37.0 37.0 37.0 37.0 50-51 35.5355 37.0 37.0 37.0 37.0 37.0 52-53 35.38453975993998 37.0 37.0 37.0 37.0 37.0 54-55 35.491372843210804 37.0 37.0 37.0 37.0 37.0 56-57 35.47036759189797 37.0 37.0 37.0 37.0 37.0 58-59 35.47186796699175 37.0 37.0 37.0 37.0 37.0 60-61 35.43635908977244 37.0 37.0 37.0 37.0 37.0 62-63 35.44161040260065 37.0 37.0 37.0 37.0 37.0 64-65 35.377594398599655 37.0 37.0 37.0 37.0 37.0 66-67 35.31182795698925 37.0 37.0 37.0 37.0 37.0 68-69 35.45661415353838 37.0 37.0 37.0 37.0 37.0 70-71 35.31932983245811 37.0 37.0 37.0 31.0 37.0 72-73 35.281570392598155 37.0 37.0 37.0 31.0 37.0 74-75 35.36134033508377 37.0 37.0 37.0 31.0 37.0 76-77 35.29782445611403 37.0 37.0 37.0 37.0 37.0 78-79 35.19054763690923 37.0 37.0 37.0 25.0 37.0 80-81 35.192048012003 37.0 37.0 37.0 25.0 37.0 82-83 35.26433984684265 37.0 37.0 37.0 31.0 37.0 84-85 35.174087043521766 37.0 37.0 37.0 25.0 37.0 86-87 35.20485242621311 37.0 37.0 37.0 31.0 37.0 88-89 35.33770938509034 37.0 37.0 37.0 37.0 37.0 90-91 35.26229984678045 37.0 37.0 37.0 31.0 37.0 92-93 35.28092138207311 37.0 37.0 37.0 31.0 37.0 94-95 35.25287931897847 37.0 37.0 37.0 31.0 37.0 96-97 35.15920419438089 37.0 37.0 37.0 25.0 37.0 98-99 35.19896692782899 37.0 37.0 37.0 25.0 37.0 100-101 35.072071914503525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 3.0 23 3.0 24 4.0 25 5.0 26 14.0 27 27.0 28 44.0 29 61.0 30 77.0 31 108.0 32 142.0 33 171.0 34 274.0 35 544.0 36 2056.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.250000000000004 13.475000000000001 19.625 39.65 2 24.993669283362877 20.0050645733097 31.906811851101548 23.09445429222588 3 27.1 22.775000000000002 23.0 27.125 4 26.674999999999997 29.349999999999998 18.325 25.650000000000002 5 26.924999999999997 30.875000000000004 20.3 21.9 6 20.349999999999998 34.025 22.325 23.3 7 20.549999999999997 16.6 38.1 24.75 8 21.65 20.075000000000003 26.05 32.225 9 21.375 21.55 28.7 28.375 10-11 24.675 28.537499999999998 20.0375 26.75 12-13 24.025 22.175 26.950000000000003 26.85 14-15 24.025 24.2 25.7875 25.9875 16-17 24.1875 24.9 24.7 26.2125 18-19 24.4375 25.424999999999997 24.6 25.5375 20-21 23.7625 25.025 25.1875 26.025 22-23 24.337500000000002 24.462500000000002 25.587500000000002 25.6125 24-25 25.337500000000002 24.462500000000002 24.4 25.8 26-27 24.6625 25.8 24.3125 25.224999999999998 28-29 24.087500000000002 24.2875 24.087500000000002 27.537499999999998 30-31 23.9 24.2 24.349999999999998 27.55 32-33 24.2 26.0625 24.4 25.337500000000002 34-35 24.825 24.275 24.4375 26.4625 36-37 24.5375 25.137500000000003 23.6125 26.7125 38-39 24.7375 24.7375 24.637500000000003 25.887500000000003 40-41 24.5375 25.074999999999996 24.425 25.9625 42-43 23.962500000000002 25.6 24.962500000000002 25.474999999999998 44-45 25.112499999999997 24.55 24.462500000000002 25.874999999999996 46-47 25.2 25.2125 24.3875 25.2 48-49 24.0375 24.975 25.2875 25.7 50-51 25.224999999999998 25.525 23.5875 25.662499999999998 52-53 26.078259782472806 24.153019127390923 23.6029503687961 26.16577072134017 54-55 24.706176544136035 24.718679669917478 25.268817204301076 25.30632658164541 56-57 24.006001500375092 24.356089022255563 25.156289072268066 26.481620405101275 58-59 25.318829707426854 25.481370342585645 23.893473368342086 25.30632658164541 60-61 24.18104526131533 25.85646411602901 23.718429607401852 26.244061015253813 62-63 24.06851712928232 24.85621405351338 24.468617154288573 26.60665166291573 64-65 24.918729682420604 24.281070267566893 24.731182795698924 26.069017254313575 66-67 23.468367091772944 24.69367341835459 25.593898474618655 26.244061015253813 68-69 25.206301575393848 24.48112028007002 24.69367341835459 25.618904726181547 70-71 24.981245311327832 25.78144536134033 23.755938984746187 25.481370342585645 72-73 25.406351587896975 24.36859214803701 24.88122030507627 25.343835958989747 74-75 25.55638909727432 24.10602650662666 25.081270317579396 25.256314078519633 76-77 25.1937984496124 24.568642160540136 24.143535883970994 26.094023505876468 78-79 24.81870467616904 24.681170292573142 24.843710927731934 25.656414103525883 80-81 24.85621405351338 24.33108277069267 24.843710927731934 25.968992248062015 82-83 25.922220832812304 23.471301738151805 24.534200325121923 26.072277103913965 84-85 25.275137568784395 23.836918459229615 23.974487243621812 26.91345672836418 86-87 25.0 25.362681340670335 24.787393696848426 24.84992496248124 88-89 25.691056910569106 24.590368980612883 23.877423389618514 25.8411507191995 90-91 25.516205731447876 24.502565386059317 24.677762482793142 25.303466399699666 92-93 24.54932398597897 25.087631447170754 23.985978968452677 26.377065598397596 94-95 25.037556334501755 25.676014021031545 23.823234852278418 25.463194792188283 96-97 25.63941825476429 24.297893681043128 23.946840521564695 26.115847542627886 98-99 25.98525298754132 23.30282227307399 23.98932112890923 26.722603610475463 100-101 25.710695775090308 11.685252081042877 31.396261975812784 31.20779016805403 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 2.0 3 1.0 4 0.5 5 1.0 6 0.5 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 1.0 23 1.0 24 1.0 25 1.5 26 1.0 27 1.0 28 2.0 29 4.0 30 5.5 31 10.5 32 14.0 33 15.5 34 22.0 35 34.0 36 45.5 37 63.0 38 80.5 39 83.5 40 98.5 41 125.5 42 158.5 43 175.5 44 165.0 45 151.0 46 151.0 47 184.0 48 193.5 49 167.0 50 166.0 51 157.5 52 134.5 53 124.5 54 116.5 55 101.5 56 91.5 57 91.5 58 82.5 59 77.0 60 72.0 61 65.5 62 67.0 63 64.0 64 67.5 65 74.0 66 66.0 67 54.5 68 52.0 69 50.0 70 45.0 71 42.5 72 45.5 73 36.5 74 22.5 75 17.5 76 13.0 77 11.5 78 9.0 79 5.5 80 2.5 81 3.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.275 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 52-53 1.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 1.0 84-85 0.0 86-87 0.0 88-89 2.0 90-91 2.0 92-93 0.0 94-95 3.0 96-97 23.0 98-99 353.0 100-101 3615.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 92.83977303431506 85.9 2 6.565793028911106 12.15 3 0.4593353147797892 1.275 4 0.0810591731964334 0.3 5 0.027019724398811132 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027019724398811132 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 10 0.25 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971147 spots for SRR21853484.sra Written 971147 spots for SRR21853484.sra Read 971151 spots for SRR21853484.sra Written 971151 spots for SRR21853484.sra SRR ids: ['SRR21853484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7v9nkq6 SRR21853484.sra spots: 19422944 blocks: [[1, 971147], [971148, 1942294], [1942295, 2913441], [2913442, 3884588], [3884589, 4855735], [4855736, 5826882], [5826883, 6798029], [6798030, 7769176], [7769177, 8740323], [8740324, 9711470], [9711471, 10682617], [10682618, 11653764], [11653765, 12624911], [12624912, 13596058], [13596059, 14567205], [14567206, 15538352], [15538353, 16509499], [16509500, 17480646], [17480647, 18451793], [18451794, 19422944]] SRR21853484 file size 5232544 SRR21853484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853484 SRR21853484_1.fastq Input file: SRR21853484_1.fastq trimmed: SRR21853484-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 15:56:15 2024 >> started Fri Dec 6 15:56:32 2024 >> done (16.693s) 19422944 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 30118 ( 0.16%) empty reads filtered out after trimming by size control 19392822 (99.84%) reads available; of these: 320 ( 0.00%) trimmed reads available after processing 19392502 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 3 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 1 0.00% 30 4 0.00% 31 1 0.00% 32 2 0.00% 33 4 0.00% 34 3 0.00% 35 64 0.00% 36 55 0.00% 37 74 0.00% 38 62 0.00% 39 73 0.00% 40 68 0.00% 41 81 0.00% 42 75 0.00% 43 92 0.00% 44 79 0.00% 45 87 0.00% 46 79 0.00% 47 62 0.00% 48 105 0.00% 49 100 0.00% 50 93 0.00% 51 100 0.00% 52 111 0.00% 53 126 0.00% 54 112 0.00% 55 130 0.00% 56 133 0.00% 57 113 0.00% 58 142 0.00% 59 146 0.00% 60 156 0.00% 61 156 0.00% 62 136 0.00% 63 162 0.00% 64 152 0.00% 65 161 0.00% 66 176 0.00% 67 161 0.00% 68 161 0.00% 69 164 0.00% 70 182 0.00% 71 210 0.00% 72 182 0.00% 73 238 0.00% 74 208 0.00% 75 167 0.00% 76 196 0.00% 77 209 0.00% 78 239 0.00% 79 260 0.00% 80 275 0.00% 81 251 0.00% 82 320 0.00% 83 298 0.00% 84 310 0.00% 85 352 0.00% 86 371 0.00% 87 362 0.00% 88 392 0.00% 89 490 0.00% 90 518 0.00% 91 1079 0.01% 92 578 0.00% 93 660 0.00% 94 1519 0.01% 95 5201 0.03% 96 27163 0.14% 97 92484 0.48% 98 360771 1.86% 99 1304277 6.73% 100 4430322 22.85% 101 13158758 67.85% 19392822 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=190.92 fanout-score-rank=12 prefix-density=0.77 prefix-fanout=23.5 sequence=CCGCCGCCGCCG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=390.86 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=26.0 sequence=CGCCGCCGCCTCC Started job on | Dec 06 15:56:49 Started mapping on | Dec 06 15:56:49 Finished on | Dec 06 15:57:20 Mapping speed, Million of reads per hour | 2252.07 Number of input reads | 19392822 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 18091765 Uniquely mapped reads % | 93.29% Average mapped length | 100.22 Number of splices: Total | 6356317 Number of splices: Annotated (sjdb) | 6010480 Number of splices: GT/AG | 6271949 Number of splices: GC/AG | 70691 Number of splices: AT/AC | 3490 Number of splices: Non-canonical | 10187 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.00% Deletion average length | 1.93 Insertion rate per base | 0.00% Insertion average length | 1.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418297 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 434572 % of reads mapped to too many loci | 2.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 882760 882760 882760 N_multimapping 418297 418297 418297 N_noFeature 836601 9274765 9409944 N_ambiguous 280211 17878 20184 UnstrandedReadsAssigned:16974953 PositiveStrandReadsAssigned:8799122 NegativeStrandReadsAssigned:8661637 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853484 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853484-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,392,822 reads, 17,531,958 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR21853484.ke.tsv 35125 SRR21853484.se.tsv 88098 total ==> SRR21853484.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.836565 0.0987921 PNS24247 1044 945 61.1464 6.39568 PNS24249 1928 1829 207.736 11.2266 PNS24246 1044 945 61.1464 6.39568 PNS24248 1044 945 61.1464 6.39568 PNS24244 1471 1372 63.9879 4.6099 PNS24243 293 194 23 11.7186 KQK14069 1603 1504 4307.31 283.078 KQK14071 474 375 766.176 201.951 ==> SRR21853484.se.tsv <== BRADI_1g14170v3 5503 BRADI_1g53295v3 455 BRADI_1g59795v3 368 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 221 BRADI_1g74790v3 572 BRADI_1g09890v3 0 BRADI_1g77505v3 182 BRADI_1g48960v3 0 SRR21853484 completed mapping pipeline successfully