Starting /dee2/code/volunteer_pipeline.sh SRR21853486 current disk space = 1550457888768 free memory = 1599387656 SRR21853486 SRAfilesize fd9a810007a5eb67299effd157a07a45 SRR21853486.sra SRR21853486.sra file validated SRR21853486 is single end SRR21853486 is conventional basespace SRR21853486 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.11625 37.0 37.0 37.0 25.0 37.0 2 35.28625 37.0 37.0 37.0 37.0 37.0 3 35.55525 37.0 37.0 37.0 37.0 37.0 4 35.70525 37.0 37.0 37.0 37.0 37.0 5 35.80825 37.0 37.0 37.0 37.0 37.0 6 35.75175 37.0 37.0 37.0 37.0 37.0 7 35.51675 37.0 37.0 37.0 37.0 37.0 8 35.84875 37.0 37.0 37.0 37.0 37.0 9 35.76725 37.0 37.0 37.0 37.0 37.0 10-11 35.759249999999994 37.0 37.0 37.0 37.0 37.0 12-13 35.829 37.0 37.0 37.0 37.0 37.0 14-15 35.74075 37.0 37.0 37.0 37.0 37.0 16-17 35.751999999999995 37.0 37.0 37.0 37.0 37.0 18-19 35.82675 37.0 37.0 37.0 37.0 37.0 20-21 35.7575 37.0 37.0 37.0 37.0 37.0 22-23 35.71875 37.0 37.0 37.0 37.0 37.0 24-25 35.59525 37.0 37.0 37.0 37.0 37.0 26-27 35.5865 37.0 37.0 37.0 37.0 37.0 28-29 35.546499999999995 37.0 37.0 37.0 37.0 37.0 30-31 35.430499999999995 37.0 37.0 37.0 37.0 37.0 32-33 35.58975 37.0 37.0 37.0 37.0 37.0 34-35 35.5325 37.0 37.0 37.0 37.0 37.0 36-37 35.59364841210302 37.0 37.0 37.0 37.0 37.0 38-39 35.44361090272568 37.0 37.0 37.0 37.0 37.0 40-41 35.376344086021504 37.0 37.0 37.0 37.0 37.0 42-43 35.46636659164791 37.0 37.0 37.0 37.0 37.0 44-45 35.4048512128032 37.0 37.0 37.0 37.0 37.0 46-47 35.45811452863216 37.0 37.0 37.0 37.0 37.0 48-49 35.44036009002251 37.0 37.0 37.0 37.0 37.0 50-51 35.459614903725935 37.0 37.0 37.0 37.0 37.0 52-53 35.44311077769443 37.0 37.0 37.0 37.0 37.0 54-55 35.400350087521886 37.0 37.0 37.0 37.0 37.0 56-57 35.32541270635318 37.0 37.0 37.0 37.0 37.0 58-59 35.458479239619805 37.0 37.0 37.0 37.0 37.0 60-61 35.43721860930465 37.0 37.0 37.0 37.0 37.0 62-63 35.35817908954478 37.0 37.0 37.0 31.0 37.0 64-65 35.29089544772386 37.0 37.0 37.0 31.0 37.0 66-67 35.2776388194097 37.0 37.0 37.0 31.0 37.0 68-69 35.19434717358679 37.0 37.0 37.0 25.0 37.0 70-71 35.23536768384192 37.0 37.0 37.0 31.0 37.0 72-73 35.28714357178589 37.0 37.0 37.0 37.0 37.0 74-75 35.345172586293145 37.0 37.0 37.0 31.0 37.0 76-77 35.11630815407704 37.0 37.0 37.0 25.0 37.0 78-79 35.336918459229615 37.0 37.0 37.0 37.0 37.0 80-81 35.32694887598916 37.0 37.0 37.0 31.0 37.0 82-83 35.21165874405804 37.0 37.0 37.0 25.0 37.0 84-85 35.202151613710285 37.0 37.0 37.0 25.0 37.0 86-87 35.22742056542407 37.0 37.0 37.0 25.0 37.0 88-89 35.28246184638479 37.0 37.0 37.0 31.0 37.0 90-91 35.137603202401806 37.0 37.0 37.0 25.0 37.0 92-93 35.21140855641731 37.0 37.0 37.0 31.0 37.0 94-95 35.032788608978635 37.0 37.0 37.0 25.0 37.0 96-97 35.053893112565774 37.0 37.0 37.0 25.0 37.0 98-99 35.25293669761501 37.0 37.0 37.0 31.0 37.0 100-101 35.04952002386172 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 4.0 22 2.0 23 3.0 24 5.0 25 8.0 26 13.0 27 33.0 28 49.0 29 65.0 30 76.0 31 102.0 32 148.0 33 193.0 34 260.0 35 539.0 36 2023.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.256314078519633 13.628407101775444 17.829457364341085 43.285821455363845 2 24.028091296714322 20.692249811888637 31.477301228994232 23.80235766240281 3 26.281570392598148 23.1807951987997 22.88072018004501 27.656914228557138 4 26.506626656664167 30.282570642660666 18.904726181545385 24.306076519129782 5 27.656914228557138 29.707426856714182 21.330332583145786 21.305326331582897 6 21.655413853463365 32.10802700675169 21.555388847211805 24.681170292573142 7 19.254813703425857 16.954238559639908 39.95998999749937 23.830957739434858 8 22.155538884721178 22.48062015503876 25.85646411602901 29.507376844211052 9 21.80545136284071 22.280570142535634 28.307076769192296 27.60690172543136 10-11 25.418854713678417 28.582145536384097 20.517629407351837 25.481370342585645 12-13 23.55588897224306 22.780695173793447 25.943985996499126 27.719429857464366 14-15 24.143535883970994 24.418604651162788 25.506376594148538 25.93148287071768 16-17 23.593398349587396 24.568642160540136 25.256314078519633 26.581645411352838 18-19 23.393348337084273 24.981245311327832 24.681170292573142 26.944236059014752 20-21 25.09377344336084 24.60615153788447 24.18104526131533 26.11902975743936 22-23 24.3935983995999 25.656414103525883 24.243560890222557 25.70642660665166 24-25 23.605901475368842 23.99349837459365 26.131532883220803 26.269067266816705 26-27 24.60615153788447 24.981245311327832 24.118529632408105 26.294073518379594 28-29 25.143785946486624 25.18129532383096 24.63115778944736 25.04376094023506 30-31 23.655913978494624 25.168792198049513 24.731182795698924 26.44411102775694 32-33 24.618654663665918 24.656164041010253 24.76869217304326 25.95648912228057 34-35 24.418604651162788 24.643660915228807 24.69367341835459 26.244061015253813 36-37 24.93123280820205 23.93098274568642 25.618904726181547 25.51887971992998 38-39 23.680920230057513 25.09377344336084 24.81870467616904 26.406601650412604 40-41 24.593648412103025 25.456364091022753 24.18104526131533 25.76894223555889 42-43 24.81870467616904 25.156289072268066 25.28132033008252 24.74368592148037 44-45 24.81870467616904 24.918729682420604 24.74368592148037 25.51887971992998 46-47 23.968492123030757 25.36884221055264 24.756189047261813 25.906476619154787 48-49 23.818454613653415 25.318829707426854 25.206301575393848 25.656414103525883 50-51 24.893723430857715 25.143785946486624 24.99374843710928 24.968742185546386 52-53 25.143785946486624 24.431107776944234 24.281070267566893 26.144036009002253 54-55 24.656164041010253 26.51912978244561 23.468367091772944 25.35633908477119 56-57 24.58729364682341 24.449724862431214 24.64982491245623 26.313156578289142 58-59 24.83741870935468 24.312156078039017 25.125062531265634 25.72536268134067 60-61 24.912456228114056 26.100550275137568 24.424712356178087 24.562281140570285 62-63 25.237618809404704 24.937468734367183 24.499749874937468 25.325162581290645 64-65 25.57528764382191 24.874937468734366 23.999499749874936 25.550275137568786 66-67 25.52526263131566 25.50025012506253 24.512256128064035 24.462231115557778 68-69 24.474737368684345 25.76288144072036 24.262131065532767 25.50025012506253 70-71 25.350175087543768 24.73736868434217 24.79989994997499 25.11255627813907 72-73 25.337668834417208 24.274637318659327 25.07503751875938 25.312656328164078 74-75 25.362681340670335 24.224612306153077 24.212106053026513 26.20060030015007 76-77 25.475237618809405 25.125062531265634 23.71185592796398 25.68784392196098 78-79 25.087543771885944 25.437718859429715 23.699349674837418 25.775387693846923 80-81 26.479049405878673 25.56597873671044 23.97748592870544 23.97748592870544 82-83 26.194645984488368 24.88116087065299 24.180635476607456 24.74355766825119 84-85 25.056292219164373 25.01876407305479 24.11808856642482 25.806855141356017 86-87 25.581686264698522 24.59344508381286 24.88116087065299 24.943707780835627 88-89 26.432324243182386 23.980485364023014 24.168126094570926 25.41906429822367 90-91 25.469101826369776 25.64423317488116 23.455091318488865 25.431573680260193 92-93 25.41906429822367 25.168876657493122 23.91793845384038 25.494120590442833 94-95 27.027027027027028 24.537037037037038 22.94794794794795 25.487987987987985 96-97 25.35705337008269 24.893510398396394 24.7557003257329 24.99373590578802 98-99 25.3015107274343 23.62574584232576 25.238034784816556 25.834708645423383 100-101 26.3501672773618 11.486378843396528 30.715309861398758 31.448144017842917 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.0 26 1.5 27 2.0 28 2.0 29 4.5 30 9.0 31 12.0 32 11.0 33 14.0 34 24.0 35 35.5 36 42.5 37 50.0 38 78.0 39 102.0 40 108.0 41 140.5 42 167.5 43 158.0 44 161.5 45 176.0 46 200.0 47 191.5 48 171.0 49 161.5 50 139.0 51 149.5 52 153.5 53 127.5 54 112.5 55 111.5 56 100.0 57 87.0 58 84.0 59 79.5 60 67.5 61 66.5 62 70.0 63 60.0 64 52.5 65 67.0 66 64.5 67 45.5 68 46.0 69 46.0 70 40.5 71 33.0 72 27.5 73 32.0 74 32.0 75 21.0 76 14.5 77 11.5 78 10.5 79 6.5 80 2.5 81 2.5 82 2.5 83 2.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.325 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 1.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 1.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 2.0 96-97 25.0 98-99 361.0 100-101 3609.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.0392584514722 84.39999999999999 2 7.360959651035986 13.5 3 0.49073064340239914 1.35 4 0.0 0.0 5 0.08178844056706652 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02726281352235551 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 15 0.375 TruSeq Adapter, Index 1 (97% over 36bp) CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 5 0.125 TruSeq Adapter, Index 1 (97% over 36bp) CAAAACCAACCAAGACAAGTTGGACACTGAAATTTTTGAATTGTACATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAACC 15 6.275708E-4 94.487495 2 >>END_MODULE Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195657 spots for SRR21853486.sra Written 195657 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra Read 195646 spots for SRR21853486.sra Written 195646 spots for SRR21853486.sra SRR ids: ['SRR21853486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aj2f7iyn SRR21853486.sra spots: 3912931 blocks: [[1, 195646], [195647, 391292], [391293, 586938], [586939, 782584], [782585, 978230], [978231, 1173876], [1173877, 1369522], [1369523, 1565168], [1565169, 1760814], [1760815, 1956460], [1956461, 2152106], [2152107, 2347752], [2347753, 2543398], [2543399, 2739044], [2739045, 2934690], [2934691, 3130336], [3130337, 3325982], [3325983, 3521628], [3521629, 3717274], [3717275, 3912931]] SRR21853486 file size 1051147 SRR21853486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853486 SRR21853486_1.fastq Input file: SRR21853486_1.fastq trimmed: SRR21853486-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:01:34 2024 >> started Fri Dec 6 16:01:37 2024 >> done (2.319s) 3912931 reads processed; of these: 22 ( 0.00%) short reads filtered out after trimming by size control 32441 ( 0.83%) empty reads filtered out after trimming by size control 3880468 (99.17%) reads available; of these: 120 ( 0.00%) trimmed reads available after processing 3880348 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 4 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 3 0.00% 35 39 0.00% 36 47 0.00% 37 39 0.00% 38 44 0.00% 39 27 0.00% 40 35 0.00% 41 44 0.00% 42 40 0.00% 43 46 0.00% 44 48 0.00% 45 34 0.00% 46 37 0.00% 47 47 0.00% 48 60 0.00% 49 45 0.00% 50 37 0.00% 51 47 0.00% 52 52 0.00% 53 43 0.00% 54 49 0.00% 55 53 0.00% 56 43 0.00% 57 46 0.00% 58 59 0.00% 59 46 0.00% 60 65 0.00% 61 57 0.00% 62 76 0.00% 63 53 0.00% 64 60 0.00% 65 42 0.00% 66 55 0.00% 67 47 0.00% 68 72 0.00% 69 69 0.00% 70 60 0.00% 71 56 0.00% 72 59 0.00% 73 55 0.00% 74 69 0.00% 75 96 0.00% 76 78 0.00% 77 73 0.00% 78 65 0.00% 79 71 0.00% 80 87 0.00% 81 89 0.00% 82 82 0.00% 83 82 0.00% 84 100 0.00% 85 88 0.00% 86 98 0.00% 87 105 0.00% 88 110 0.00% 89 122 0.00% 90 135 0.00% 91 278 0.01% 92 152 0.00% 93 181 0.00% 94 308 0.01% 95 960 0.02% 96 5236 0.13% 97 18838 0.49% 98 71576 1.84% 99 260681 6.72% 100 895860 23.09% 101 2622897 67.59% 3880468 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.21 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=11 fanout-score=181.15 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=23.0 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:01:52 Started mapping on | Dec 06 16:01:52 Finished on | Dec 06 16:02:01 Mapping speed, Million of reads per hour | 1552.19 Number of input reads | 3880468 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3391864 Uniquely mapped reads % | 87.41% Average mapped length | 100.25 Number of splices: Total | 1224338 Number of splices: Annotated (sjdb) | 1157377 Number of splices: GT/AG | 1207872 Number of splices: GC/AG | 14142 Number of splices: AT/AC | 809 Number of splices: Non-canonical | 1515 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 188547 % of reads mapped to multiple loci | 4.86% Number of reads mapped to too many loci | 194174 % of reads mapped to too many loci | 5.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 300057 300057 300057 N_multimapping 188547 188547 188547 N_noFeature 170209 1779888 1738211 N_ambiguous 50390 3223 3535 UnstrandedReadsAssigned:3171265 PositiveStrandReadsAssigned:1608753 NegativeStrandReadsAssigned:1650118 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853486 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853486-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,880,468 reads, 3,305,592 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52973 SRR21853486.ke.tsv 35125 SRR21853486.se.tsv 88098 total ==> SRR21853486.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 18.0413 11.4283 PNS24247 1044 945 5.83333 3.27285 PNS24249 1928 1829 24.8192 7.19474 PNS24246 1044 945 5.83333 3.27285 PNS24248 1044 945 5.83333 3.27285 PNS24244 1471 1372 11.6395 4.49803 PNS24243 293 194 4 10.932 KQK14069 1603 1504 618.414 218.008 KQK14071 474 375 52.4424 74.1467 ==> SRR21853486.se.tsv <== BRADI_1g14170v3 732 BRADI_1g53295v3 18 BRADI_1g59795v3 84 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 51 BRADI_1g74790v3 49 BRADI_1g09890v3 0 BRADI_1g77505v3 50 BRADI_1g48960v3 0 SRR21853486 completed mapping pipeline successfully