Starting /dee2/code/volunteer_pipeline.sh SRR21853487 current disk space = 1550465757184 free memory = 1597351140 SRR21853487 SRAfilesize f48f70b1aa54581ab80ffa5502f23b94 SRR21853487.sra SRR21853487.sra file validated SRR21853487 is single end SRR21853487 is conventional basespace SRR21853487 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.06125 37.0 37.0 37.0 25.0 37.0 2 35.55325 37.0 37.0 37.0 37.0 37.0 3 35.90925 37.0 37.0 37.0 37.0 37.0 4 35.77725 37.0 37.0 37.0 37.0 37.0 5 35.99025 37.0 37.0 37.0 37.0 37.0 6 35.92075 37.0 37.0 37.0 37.0 37.0 7 35.82475 37.0 37.0 37.0 37.0 37.0 8 35.85575 37.0 37.0 37.0 37.0 37.0 9 35.89475 37.0 37.0 37.0 37.0 37.0 10-11 35.95399999999999 37.0 37.0 37.0 37.0 37.0 12-13 35.88775 37.0 37.0 37.0 37.0 37.0 14-15 35.908249999999995 37.0 37.0 37.0 37.0 37.0 16-17 35.953 37.0 37.0 37.0 37.0 37.0 18-19 35.9055 37.0 37.0 37.0 37.0 37.0 20-21 35.91675 37.0 37.0 37.0 37.0 37.0 22-23 35.81575 37.0 37.0 37.0 37.0 37.0 24-25 35.8155 37.0 37.0 37.0 37.0 37.0 26-27 35.789249999999996 37.0 37.0 37.0 37.0 37.0 28-29 35.616749999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.61225 37.0 37.0 37.0 37.0 37.0 32-33 35.669250000000005 37.0 37.0 37.0 37.0 37.0 34-35 35.6465 37.0 37.0 37.0 37.0 37.0 36-37 35.73693423355839 37.0 37.0 37.0 37.0 37.0 38-39 35.60890222555639 37.0 37.0 37.0 37.0 37.0 40-41 35.59714928732183 37.0 37.0 37.0 37.0 37.0 42-43 35.6479119779945 37.0 37.0 37.0 37.0 37.0 44-45 35.46036509127282 37.0 37.0 37.0 37.0 37.0 46-47 35.48512128032008 37.0 37.0 37.0 37.0 37.0 48-49 35.329582395598905 37.0 37.0 37.0 31.0 37.0 50-51 35.550137534383595 37.0 37.0 37.0 37.0 37.0 52-53 35.37684421105276 37.0 37.0 37.0 37.0 37.0 54-55 35.421605401350334 37.0 37.0 37.0 37.0 37.0 56-57 35.435858964741186 37.0 37.0 37.0 37.0 37.0 58-59 35.39659914978745 37.0 37.0 37.0 37.0 37.0 60-61 35.426606651662915 37.0 37.0 37.0 37.0 37.0 62-63 35.29107276819205 37.0 37.0 37.0 31.0 37.0 64-65 35.19704926231557 37.0 37.0 37.0 25.0 37.0 66-67 35.2430607651913 37.0 37.0 37.0 25.0 37.0 68-69 35.18929732433108 37.0 37.0 37.0 25.0 37.0 70-71 35.166041510377596 37.0 37.0 37.0 25.0 37.0 72-73 35.0865216304076 37.0 37.0 37.0 25.0 37.0 74-75 35.08577144286072 37.0 37.0 37.0 25.0 37.0 76-77 35.157289322330584 37.0 37.0 37.0 25.0 37.0 78-79 35.092523130782695 37.0 37.0 37.0 25.0 37.0 80-81 35.170792698174544 37.0 37.0 37.0 25.0 37.0 82-83 35.15005183261798 37.0 37.0 37.0 25.0 37.0 84-85 35.045545545545544 37.0 37.0 37.0 25.0 37.0 86-87 35.09509509509509 37.0 37.0 37.0 25.0 37.0 88-89 34.77402402402402 37.0 37.0 37.0 25.0 37.0 90-91 34.844094094094096 37.0 37.0 37.0 25.0 37.0 92-93 34.859609609609606 37.0 37.0 37.0 25.0 37.0 94-95 34.95545545545546 37.0 37.0 37.0 25.0 37.0 96-97 34.65765749270757 37.0 37.0 37.0 25.0 37.0 98-99 34.70849069478509 37.0 37.0 37.0 25.0 37.0 100-101 34.699498057671946 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 0.0 22 0.0 23 3.0 24 5.0 25 9.0 26 15.0 27 12.0 28 42.0 29 42.0 30 82.0 31 95.0 32 154.0 33 208.0 34 319.0 35 681.0 36 1983.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.09457092819615 13.635226419814861 18.038528896672503 42.23167375531649 2 24.50612653163291 21.8304576144036 29.532383095773945 24.131032758189548 3 25.406351587896975 23.93098274568642 23.705926481620406 26.9567391847962 4 26.081520380095025 28.35708927231808 19.554888722180543 26.006501625406354 5 28.382095523880967 30.48262065516379 21.180295073768445 19.954988747186796 6 22.780695173793447 32.85821455363841 20.555138784696176 23.80595148787197 7 20.78019504876219 17.30432608152038 37.95948987246812 23.95598899724931 8 21.955488872218055 23.280820205051263 25.081270317579396 29.68242060515129 9 23.005751437859466 21.630407601900476 28.057014253563388 27.306826706676667 10-11 26.03150787696924 28.307076769192296 20.6176544136034 25.04376094023506 12-13 23.78094523630908 22.893223305826456 26.569142285571395 26.756689172293076 14-15 23.95598899724931 24.8062015503876 25.081270317579396 26.156539134783696 16-17 25.393848462115532 24.868717179294826 23.768442110527634 25.968992248062015 18-19 24.193548387096776 25.64391097774444 24.093523380845213 26.069017254313575 20-21 24.793698424606152 24.493623405851466 24.85621405351338 25.85646411602901 22-23 23.55588897224306 25.218804701175294 25.29382345586397 25.93148287071768 24-25 23.018254563640912 25.543885971492873 25.218804701175294 26.219054763690924 26-27 24.518629657414355 25.71892973243311 24.381095273818453 25.381345336334082 28-29 24.63115778944736 24.943735933983497 24.3935983995999 26.03150787696924 30-31 24.85621405351338 23.893473368342086 24.20605151287822 27.04426106526632 32-33 24.63115778944736 24.60615153788447 24.493623405851466 26.269067266816705 34-35 24.718679669917478 25.28132033008252 23.95598899724931 26.04401100275069 36-37 24.20565424068051 24.843632724543408 25.469101826369776 25.481611208406306 38-39 25.381345336334082 25.081270317579396 24.44361090272568 25.09377344336084 40-41 24.88122030507627 26.39409852463116 23.85596399099775 24.868717179294826 42-43 24.093523380845213 25.818954738684667 25.03125781445361 25.056264066016503 44-45 25.056292219164373 24.330748061045785 24.355766825118838 26.257192894671004 46-47 25.13134851138354 24.605954465849386 24.20565424068051 26.057042782086565 48-49 24.281070267566893 24.831207801950487 25.168792198049513 25.71892973243311 50-51 25.256314078519633 24.58114528632158 24.69367341835459 25.468867216804203 52-53 25.081270317579396 24.843710927731934 24.168542135533883 25.906476619154787 54-55 25.343835958989747 23.543385846461614 25.531382845711427 25.581395348837212 56-57 23.95598899724931 25.581395348837212 24.356089022255563 26.106526631657918 58-59 24.76869217304326 24.58114528632158 24.093523380845213 26.556639159789945 60-61 25.35633908477119 25.04376094023506 25.056264066016503 24.543635908977244 62-63 25.568892223055762 25.04376094023506 23.443360840210055 25.943985996499126 64-65 26.006501625406354 25.28132033008252 23.58089522380595 25.131282820705174 66-67 24.63115778944736 25.318829707426854 24.093523380845213 25.95648912228057 68-69 24.81870467616904 24.88122030507627 24.718679669917478 25.581395348837212 70-71 25.63140785196299 24.90622655663916 24.431107776944234 25.03125781445361 72-73 25.056264066016503 25.49387346836709 23.893473368342086 25.55638909727432 74-75 25.906476619154787 25.593898474618655 23.680920230057513 24.81870467616904 76-77 24.893723430857715 25.243810952738183 23.393348337084273 26.469117279319832 78-79 25.10627656914228 25.456364091022753 23.78094523630908 25.656414103525883 80-81 25.131282820705174 25.36884221055264 24.281070267566893 25.218804701175294 82-83 25.24696761285482 25.13442540952857 23.608853319995 26.00975365762161 84-85 25.400400400400404 24.5995995995996 24.624624624624623 25.375375375375377 86-87 25.3003003003003 25.150150150150154 24.2992992992993 25.25025025025025 88-89 26.776776776776778 24.6996996996997 23.998998998999 24.524524524524523 90-91 25.33783783783784 24.3993993993994 24.11161161161161 26.151151151151154 92-93 25.225225225225223 24.136636636636634 24.737237237237235 25.900900900900904 94-95 25.150150150150154 25.16266266266266 23.836336336336338 25.850850850850847 96-97 25.30361837986728 25.165894578690374 24.289470389382746 25.241016652059596 98-99 25.789673981986557 24.1405556260307 24.305467461626286 25.764302930356465 100-101 26.924295216978145 11.783338612606906 29.91764333227748 31.37472283813747 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 1.5 26 3.5 27 4.0 28 4.0 29 7.5 30 9.0 31 9.5 32 14.0 33 20.5 34 29.0 35 39.0 36 47.0 37 61.5 38 75.0 39 97.0 40 112.0 41 118.5 42 137.0 43 146.5 44 160.0 45 189.0 46 199.5 47 187.5 48 194.0 49 171.5 50 139.0 51 137.0 52 136.5 53 124.0 54 105.5 55 103.5 56 91.5 57 77.5 58 81.0 59 85.0 60 80.0 61 64.0 62 55.5 63 65.5 64 64.0 65 55.5 66 57.5 67 53.5 68 51.0 69 56.0 70 48.5 71 40.5 72 39.5 73 30.5 74 24.5 75 25.5 76 19.0 77 12.0 78 12.0 79 9.5 80 5.0 81 2.0 82 1.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.05001250312578145 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.05001250312578145 46-47 0.05001250312578145 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 3.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 20.0 98-99 334.0 100-101 3641.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.05 #Duplication Level Percentage of deduplicated Percentage of total 1 93.41751746372918 86.925 2 6.018269747447609 11.200000000000001 3 0.537345513164965 1.5 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026867275658248254 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 15 0.375 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114013 spots for SRR21853487.sra Written 114013 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra Read 114012 spots for SRR21853487.sra Written 114012 spots for SRR21853487.sra SRR ids: ['SRR21853487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3cyfa2v7 SRR21853487.sra spots: 2280241 blocks: [[1, 114012], [114013, 228024], [228025, 342036], [342037, 456048], [456049, 570060], [570061, 684072], [684073, 798084], [798085, 912096], [912097, 1026108], [1026109, 1140120], [1140121, 1254132], [1254133, 1368144], [1368145, 1482156], [1482157, 1596168], [1596169, 1710180], [1710181, 1824192], [1824193, 1938204], [1938205, 2052216], [2052217, 2166228], [2166229, 2280241]] SRR21853487 file size 612199 SRR21853487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853487 SRR21853487_1.fastq Input file: SRR21853487_1.fastq trimmed: SRR21853487-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:02:25 2024 >> started Fri Dec 6 16:02:27 2024 >> done (1.680s) 2280241 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 14192 ( 0.62%) empty reads filtered out after trimming by size control 2266044 (99.38%) reads available; of these: 146 ( 0.01%) trimmed reads available after processing 2265898 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 7 0.00% 36 13 0.00% 37 18 0.00% 38 17 0.00% 39 21 0.00% 40 14 0.00% 41 13 0.00% 42 10 0.00% 43 18 0.00% 44 17 0.00% 45 16 0.00% 46 10 0.00% 47 12 0.00% 48 16 0.00% 49 16 0.00% 50 14 0.00% 51 18 0.00% 52 15 0.00% 53 19 0.00% 54 15 0.00% 55 14 0.00% 56 25 0.00% 57 20 0.00% 58 9 0.00% 59 19 0.00% 60 13 0.00% 61 19 0.00% 62 24 0.00% 63 23 0.00% 64 19 0.00% 65 26 0.00% 66 20 0.00% 67 24 0.00% 68 19 0.00% 69 30 0.00% 70 25 0.00% 71 24 0.00% 72 16 0.00% 73 29 0.00% 74 19 0.00% 75 27 0.00% 76 28 0.00% 77 26 0.00% 78 19 0.00% 79 25 0.00% 80 36 0.00% 81 26 0.00% 82 29 0.00% 83 37 0.00% 84 35 0.00% 85 37 0.00% 86 30 0.00% 87 44 0.00% 88 39 0.00% 89 50 0.00% 90 54 0.00% 91 153 0.01% 92 66 0.00% 93 77 0.00% 94 153 0.01% 95 497 0.02% 96 2996 0.13% 97 11203 0.49% 98 41360 1.83% 99 151516 6.69% 100 522011 23.04% 101 1534751 67.73% 2266044 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=243.15 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=23.7 sequence=CCGCCGCCGCCA Started job on | Dec 06 16:02:44 Started mapping on | Dec 06 16:02:44 Finished on | Dec 06 16:02:49 Mapping speed, Million of reads per hour | 1631.55 Number of input reads | 2266044 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 1985436 Uniquely mapped reads % | 87.62% Average mapped length | 100.29 Number of splices: Total | 713024 Number of splices: Annotated (sjdb) | 674012 Number of splices: GT/AG | 703529 Number of splices: GC/AG | 8284 Number of splices: AT/AC | 435 Number of splices: Non-canonical | 776 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 104085 % of reads mapped to multiple loci | 4.59% Number of reads mapped to too many loci | 118368 % of reads mapped to too many loci | 5.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.13% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 176523 176523 176523 N_multimapping 104085 104085 104085 N_noFeature 98356 1045276 1013314 N_ambiguous 29053 1942 2088 UnstrandedReadsAssigned:1858027 PositiveStrandReadsAssigned:938218 NegativeStrandReadsAssigned:970034 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853487 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853487-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,266,044 reads, 1,936,183 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,010 rounds 52973 SRR21853487.ke.tsv 35125 SRR21853487.se.tsv 88098 total ==> SRR21853487.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 8.91836 8.62583 PNS24249 1928 1829 17.2449 8.61777 PNS24246 1044 945 8.91836 8.62583 PNS24248 1044 945 8.91836 8.62583 PNS24244 1471 1372 0 0 PNS24243 293 194 3 14.1341 KQK14069 1603 1504 296.324 180.081 KQK14071 474 375 40.3364 98.3137 ==> SRR21853487.se.tsv <== BRADI_1g14170v3 398 BRADI_1g53295v3 14 BRADI_1g59795v3 46 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 27 BRADI_1g74790v3 42 BRADI_1g09890v3 0 BRADI_1g77505v3 28 BRADI_1g48960v3 0 SRR21853487 completed mapping pipeline successfully