Starting /dee2/code/volunteer_pipeline.sh SRR21853488 current disk space = 1550506532864 free memory = 1596963180 SRR21853488 SRAfilesize 5ca01a093aedce1fefb91a3756a282a3 SRR21853488.sra SRR21853488.sra file validated SRR21853488 is single end SRR21853488 is conventional basespace SRR21853488 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.23275 32.0 32.0 32.0 32.0 32.0 2 31.41375 32.0 32.0 32.0 32.0 32.0 3 31.43375 32.0 32.0 32.0 32.0 32.0 4 31.5595 32.0 32.0 32.0 32.0 32.0 5 31.55525 32.0 32.0 32.0 32.0 32.0 6 34.87725 36.0 36.0 36.0 36.0 36.0 7 35.24725 36.0 36.0 36.0 36.0 36.0 8 35.06275 36.0 36.0 36.0 36.0 36.0 9 34.985 36.0 36.0 36.0 36.0 36.0 10-11 35.088750000000005 36.0 36.0 36.0 36.0 36.0 12-13 35.079875 36.0 36.0 36.0 36.0 36.0 14-15 35.074625 36.0 36.0 36.0 36.0 36.0 16-17 35.03475 36.0 36.0 36.0 36.0 36.0 18-19 34.97775 36.0 36.0 36.0 36.0 36.0 20-21 35.1275 36.0 36.0 36.0 36.0 36.0 22-23 35.038250000000005 36.0 36.0 36.0 36.0 36.0 24-25 35.002625 36.0 36.0 36.0 36.0 36.0 26-27 34.89775 36.0 36.0 36.0 36.0 36.0 28-29 34.998000000000005 36.0 36.0 36.0 36.0 36.0 30-31 34.902 36.0 36.0 36.0 36.0 36.0 32-33 34.823625 36.0 36.0 36.0 34.0 36.0 34-35 34.82925 36.0 36.0 36.0 34.0 36.0 36-37 34.71155288822206 36.0 36.0 36.0 32.0 36.0 38-39 34.632658164541134 36.0 36.0 36.0 32.0 36.0 40-41 34.72505626406601 36.0 36.0 36.0 34.0 36.0 42-43 34.76956739184796 36.0 36.0 36.0 34.0 36.0 44-45 34.57964491122781 36.0 36.0 36.0 32.0 36.0 46-47 34.74181045261315 36.0 36.0 36.0 32.0 36.0 48-49 34.716429107276824 36.0 36.0 36.0 32.0 36.0 50-51 34.62465616404101 36.0 36.0 36.0 32.0 36.0 52-53 34.637159289822456 36.0 36.0 36.0 32.0 36.0 54-55 34.51712928232058 36.0 36.0 36.0 32.0 36.0 56-57 34.44123530882721 36.0 36.0 36.0 32.0 36.0 58-59 34.323205801450364 36.0 36.0 36.0 32.0 36.0 60-61 34.4925594517689 36.0 36.0 36.0 32.0 36.0 62-63 34.31390695347674 36.0 36.0 36.0 32.0 36.0 64-65 34.316283141570786 36.0 36.0 36.0 32.0 36.0 66-67 34.23386693346673 36.0 36.0 36.0 32.0 36.0 68-69 34.35005002501251 36.0 36.0 36.0 32.0 36.0 70-71 34.02376188094047 36.0 36.0 36.0 32.0 36.0 72-73 34.20972986493247 36.0 36.0 36.0 32.0 36.0 74-75 33.797773886943475 36.0 36.0 36.0 27.0 36.0 76-77 33.86193096548274 36.0 36.0 36.0 27.0 36.0 78-79 34.03989494747374 36.0 36.0 36.0 32.0 36.0 80-81 34.002626313156576 36.0 36.0 36.0 32.0 36.0 82-83 34.05115057528764 36.0 36.0 36.0 32.0 36.0 84-85 33.981365682841414 36.0 36.0 36.0 29.5 36.0 86-87 33.95308377856679 36.0 36.0 36.0 29.5 36.0 88-89 33.834751063297475 36.0 36.0 36.0 29.5 36.0 90-91 33.91343507630723 36.0 36.0 36.0 29.5 36.0 92-93 33.89379534650988 36.0 36.0 36.0 29.5 36.0 94-95 33.8742807105329 36.0 36.0 36.0 29.5 36.0 96-97 33.80942897921725 36.0 36.0 36.0 27.0 36.0 98-99 33.79246087861165 36.0 36.0 36.0 27.0 36.0 100-101 32.96155278348573 36.0 34.0 36.0 20.5 36.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 11101 1 0.0 11101 2 0.0 11101 3 0.0 11101 4 0.0 11101 5 0.0 11101 6 0.0 11101 7 0.0 11101 8 0.0 11101 9 0.0 11101 10-11 0.0 11101 12-13 0.0 11101 14-15 0.0 11101 16-17 0.0 11101 18-19 0.0 11101 20-21 0.0 11101 22-23 0.0 11101 24-25 0.0 11101 26-27 0.0 11101 28-29 0.0 11101 30-31 0.0 11101 32-33 0.0 11101 34-35 0.0 11101 36-37 0.0 11101 38-39 0.0 11101 40-41 0.0 11101 42-43 0.0 11101 44-45 0.0 11101 46-47 0.0 11101 48-49 0.0 11101 50-51 0.0 11101 52-53 0.0 11101 54-55 0.0 11101 56-57 0.0 11101 58-59 0.0 11101 60-61 0.0 11101 62-63 0.0 11101 64-65 0.0 11101 66-67 0.0 11101 68-69 0.0 11101 70-71 0.0 11101 72-73 0.0 11101 74-75 0.0 11101 76-77 0.0 11101 78-79 0.0 11101 80-81 0.0 11101 82-83 0.0 11101 84-85 0.0 11101 86-87 0.0 11101 88-89 0.0 11101 90-91 0.0 11101 92-93 0.0 11101 94-95 0.0 11101 96-97 0.0 11101 98-99 0.0 11101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 3.0 19 1.0 20 3.0 21 4.0 22 3.0 23 9.0 24 11.0 25 12.0 26 22.0 27 41.0 28 57.0 29 65.0 30 89.0 31 168.0 32 187.0 33 313.0 34 675.0 35 2335.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.106526631657918 14.278569642410602 18.67966991747937 40.93523380845212 2 24.006001500375092 21.405351337834457 31.757939484871216 22.83070767691923 3 26.18154538634659 24.131032758189548 23.380845211302827 26.30657664416104 4 25.731432858214554 28.68217054263566 18.65466366591648 26.93173293323331 5 26.831707926981746 31.182795698924732 21.605401350337583 20.38009502375594 6 23.36589030803907 32.88254445279239 20.736288504883547 23.015276734285 7 19.554888722180543 17.62940735183796 38.8097024256064 24.006001500375092 8 21.780445111277817 22.58064516129032 25.906476619154787 29.732433108277068 9 23.43085771442861 21.580395098774694 28.132033008252062 26.85671417854464 10-11 26.456614153538382 28.08202050512628 20.21755438859715 25.243810952738183 12-13 23.768442110527634 23.355838959739934 25.531382845711427 27.344336084021002 14-15 22.380595148787197 25.068767191797946 25.35633908477119 27.19429857464366 16-17 25.143785946486624 25.18129532383096 23.85596399099775 25.818954738684667 18-19 23.50587646911728 25.28132033008252 24.593648412103025 26.619154788697173 20-21 25.29382345586397 24.593648412103025 25.03125781445361 25.081270317579396 22-23 24.568642160540136 26.319079769942487 24.18104526131533 24.93123280820205 24-25 24.93123280820205 25.393848462115532 23.468367091772944 26.206551637909474 26-27 24.093523380845213 25.09377344336084 23.468367091772944 27.344336084021002 28-29 24.406101525381345 25.618904726181547 24.668667166791696 25.30632658164541 30-31 24.256064016004 25.068767191797946 25.131282820705174 25.543885971492873 32-33 24.043510877719427 26.281570392598148 23.568392098024507 26.106526631657918 34-35 25.256314078519633 26.03150787696924 23.40585146286572 25.30632658164541 36-37 24.456114028507127 25.29382345586397 24.281070267566893 25.968992248062015 38-39 24.69367341835459 25.318829707426854 24.706176544136035 25.28132033008252 40-41 25.468867216804203 25.581395348837212 23.78094523630908 25.168792198049513 42-43 23.655913978494624 26.069017254313575 25.28132033008252 24.99374843710928 44-45 24.33108277069267 24.88122030507627 24.118529632408105 26.669167291822955 46-47 24.55613903475869 25.51887971992998 24.343585896474117 25.581395348837212 48-49 23.818454613653415 24.793698424606152 25.03125781445361 26.356589147286826 50-51 25.64391097774444 25.456364091022753 24.218554638659665 24.681170292573142 52-53 23.493373343335833 25.056264066016503 23.943485871467868 27.506876719179797 54-55 25.28132033008252 24.868717179294826 25.03125781445361 24.81870467616904 56-57 23.893473368342086 24.63115778944736 24.831207801950487 26.644161040260066 58-59 24.01850462615654 24.85621405351338 26.04401100275069 25.081270317579396 60-61 24.896836313617605 24.02150806552457 25.24696761285482 25.834688008003 62-63 24.19959979989995 24.474737368684345 24.68734367183592 26.638319159579787 64-65 25.45022511255628 24.874937468734366 24.412206103051524 25.26263131565783 66-67 24.074537268634316 25.100050025012504 24.424712356178087 26.40070035017509 68-69 24.049524762381193 25.56278139069535 24.7623811905953 25.625312656328163 70-71 25.07503751875938 25.82541270635318 24.312156078039017 24.787393696848426 72-73 24.449724862431214 26.413206603301653 23.611805902951478 25.52526263131566 74-75 24.512256128064035 25.60030015007504 24.024512256128062 25.86293146573287 76-77 25.7503751875938 24.73736868434217 24.73736868434217 24.77488744372186 78-79 26.28814407203602 24.599799899949975 23.43671835917959 25.67533766883442 80-81 25.82541270635318 24.79989994997499 24.437218609304654 24.937468734367183 82-83 25.76288144072036 24.81240620310155 24.562281140570285 24.862431215607803 84-85 26.76338169084542 23.724362181090545 24.19959979989995 25.312656328164078 86-87 26.16635397123202 24.777986241400875 24.152595372107566 24.90306441525954 88-89 24.981235926945207 24.280710532899676 24.843632724543408 25.894420815611706 90-91 26.044533400050035 24.64348261195897 25.381536152114087 23.930447835876908 92-93 26.582436827620715 23.567675756817614 24.83112334250688 25.01876407305479 94-95 26.870152614460846 23.855391543657746 24.043032274205654 25.23142356767576 96-97 25.75435082008263 25.015650431951926 23.337924126705897 25.892074621259546 98-99 26.06810355821961 24.0403009820176 24.71623517408494 25.175360285677844 100-101 27.828697850821744 10.445638432364095 30.24652338811631 31.479140328697852 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.5 23 2.5 24 2.5 25 2.0 26 2.0 27 3.0 28 5.0 29 7.0 30 8.5 31 9.0 32 12.0 33 17.0 34 23.0 35 35.5 36 44.5 37 56.0 38 72.5 39 82.5 40 116.0 41 149.0 42 160.0 43 165.5 44 172.0 45 186.5 46 183.5 47 168.0 48 166.0 49 168.5 50 166.5 51 147.5 52 131.5 53 131.5 54 114.5 55 98.0 56 95.0 57 91.5 58 87.0 59 85.0 60 77.5 61 67.0 62 64.5 63 60.0 64 60.0 65 63.5 66 57.5 67 51.0 68 46.0 69 40.5 70 35.0 71 40.5 72 35.0 73 26.0 74 24.5 75 18.0 76 14.0 77 11.0 78 9.5 79 5.5 80 3.5 81 4.0 82 2.5 83 2.5 84 2.0 85 0.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 2.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.17500000000000002 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 1.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 28.0 98-99 365.0 100-101 3603.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54349480091301 98.125 2 0.32969819934060357 0.65 3 0.050722799898554397 0.15 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025361399949277198 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 1 (97% over 36bp) GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGGGC 15 0.008952945 48.780643 92-93 >>END_MODULE Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233764 spots for SRR21853488.sra Written 233764 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra Read 233755 spots for SRR21853488.sra Written 233755 spots for SRR21853488.sra SRR ids: ['SRR21853488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rriivdj3 SRR21853488.sra spots: 4675109 blocks: [[1, 233755], [233756, 467510], [467511, 701265], [701266, 935020], [935021, 1168775], [1168776, 1402530], [1402531, 1636285], [1636286, 1870040], [1870041, 2103795], [2103796, 2337550], [2337551, 2571305], [2571306, 2805060], [2805061, 3038815], [3038816, 3272570], [3272571, 3506325], [3506326, 3740080], [3740081, 3973835], [3973836, 4207590], [4207591, 4441345], [4441346, 4675109]] SRR21853488 file size 1273299 SRR21853488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853488 SRR21853488_1.fastq Input file: SRR21853488_1.fastq trimmed: SRR21853488-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:03:51 2024 >> started Fri Dec 6 16:03:53 2024 >> done (2.388s) 4675109 reads processed; of these: 30 ( 0.00%) short reads filtered out after trimming by size control 79398 ( 1.70%) empty reads filtered out after trimming by size control 4595681 (98.30%) reads available; of these: 52 ( 0.00%) trimmed reads available after processing 4595629 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 1 0.00% 35 34 0.00% 36 36 0.00% 37 22 0.00% 38 38 0.00% 39 26 0.00% 40 29 0.00% 41 26 0.00% 42 29 0.00% 43 40 0.00% 44 22 0.00% 45 30 0.00% 46 23 0.00% 47 37 0.00% 48 35 0.00% 49 35 0.00% 50 25 0.00% 51 31 0.00% 52 29 0.00% 53 51 0.00% 54 44 0.00% 55 27 0.00% 56 39 0.00% 57 41 0.00% 58 52 0.00% 59 48 0.00% 60 40 0.00% 61 46 0.00% 62 45 0.00% 63 46 0.00% 64 58 0.00% 65 47 0.00% 66 63 0.00% 67 44 0.00% 68 63 0.00% 69 43 0.00% 70 62 0.00% 71 49 0.00% 72 45 0.00% 73 68 0.00% 74 58 0.00% 75 67 0.00% 76 68 0.00% 77 46 0.00% 78 62 0.00% 79 80 0.00% 80 64 0.00% 81 72 0.00% 82 79 0.00% 83 74 0.00% 84 85 0.00% 85 75 0.00% 86 81 0.00% 87 112 0.00% 88 103 0.00% 89 119 0.00% 90 150 0.00% 91 284 0.01% 92 145 0.00% 93 165 0.00% 94 338 0.01% 95 1030 0.02% 96 5775 0.13% 97 21957 0.48% 98 82797 1.80% 99 300738 6.54% 100 1055529 22.97% 101 3123953 67.98% 4595681 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.19 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=240.06 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=23.0 sequence=CCGCCGCCGCCA Started job on | Dec 06 16:04:09 Started mapping on | Dec 06 16:04:09 Finished on | Dec 06 16:04:23 Mapping speed, Million of reads per hour | 1181.75 Number of input reads | 4595681 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 3960905 Uniquely mapped reads % | 86.19% Average mapped length | 100.25 Number of splices: Total | 1426206 Number of splices: Annotated (sjdb) | 1349615 Number of splices: GT/AG | 1407450 Number of splices: GC/AG | 16360 Number of splices: AT/AC | 874 Number of splices: Non-canonical | 1522 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 211252 % of reads mapped to multiple loci | 4.60% Number of reads mapped to too many loci | 244084 % of reads mapped to too many loci | 5.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 423524 423524 423524 N_multimapping 211252 211252 211252 N_noFeature 208296 2080596 2037661 N_ambiguous 58767 3979 4238 UnstrandedReadsAssigned:3693842 PositiveStrandReadsAssigned:1876330 NegativeStrandReadsAssigned:1919006 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853488 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853488-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,595,681 reads, 3,894,908 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52973 SRR21853488.ke.tsv 35125 SRR21853488.se.tsv 88098 total ==> SRR21853488.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 13.6294 6.5432 PNS24249 1928 1829 27.2419 6.75723 PNS24246 1044 945 13.6294 6.5432 PNS24248 1044 945 13.6294 6.5432 PNS24244 1471 1372 7.86988 2.60231 PNS24243 293 194 6 14.0312 KQK14069 1603 1504 618.74 186.64 KQK14071 474 375 46.6828 56.4769 ==> SRR21853488.se.tsv <== BRADI_1g14170v3 731 BRADI_1g53295v3 40 BRADI_1g59795v3 115 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 54 BRADI_1g74790v3 72 BRADI_1g09890v3 0 BRADI_1g77505v3 55 BRADI_1g48960v3 1 SRR21853488 completed mapping pipeline successfully