Starting /dee2/code/volunteer_pipeline.sh SRR21853489 current disk space = 1550502014976 free memory = 1335722964 SRR21853489 SRAfilesize 3fdad6ba681d87ba65cb39d463ab020d SRR21853489.sra SRR21853489.sra file validated SRR21853489 is single end SRR21853489 is conventional basespace SRR21853489 read1 length is 84-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 84-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.6455 37.0 37.0 37.0 37.0 37.0 2 35.8265 37.0 37.0 37.0 37.0 37.0 3 35.9725 37.0 37.0 37.0 37.0 37.0 4 35.875 37.0 37.0 37.0 37.0 37.0 5 36.091 37.0 37.0 37.0 37.0 37.0 6 36.054 37.0 37.0 37.0 37.0 37.0 7 35.9665 37.0 37.0 37.0 37.0 37.0 8 36.233 37.0 37.0 37.0 37.0 37.0 9 36.0365 37.0 37.0 37.0 37.0 37.0 10-11 36.1155 37.0 37.0 37.0 37.0 37.0 12-13 36.089 37.0 37.0 37.0 37.0 37.0 14-15 35.960499999999996 37.0 37.0 37.0 37.0 37.0 16-17 36.025999999999996 37.0 37.0 37.0 37.0 37.0 18-19 35.98675 37.0 37.0 37.0 37.0 37.0 20-21 36.019999999999996 37.0 37.0 37.0 37.0 37.0 22-23 35.973 37.0 37.0 37.0 37.0 37.0 24-25 35.946749999999994 37.0 37.0 37.0 37.0 37.0 26-27 35.89675 37.0 37.0 37.0 37.0 37.0 28-29 35.825 37.0 37.0 37.0 37.0 37.0 30-31 35.85025 37.0 37.0 37.0 37.0 37.0 32-33 35.881 37.0 37.0 37.0 37.0 37.0 34-35 35.903 37.0 37.0 37.0 37.0 37.0 36-37 35.77525 37.0 37.0 37.0 37.0 37.0 38-39 35.808 37.0 37.0 37.0 37.0 37.0 40-41 35.84675 37.0 37.0 37.0 37.0 37.0 42-43 35.7285 37.0 37.0 37.0 37.0 37.0 44-45 35.656499999999994 37.0 37.0 37.0 37.0 37.0 46-47 35.81725 37.0 37.0 37.0 37.0 37.0 48-49 35.698 37.0 37.0 37.0 37.0 37.0 50-51 35.743 37.0 37.0 37.0 37.0 37.0 52-53 35.76675 37.0 37.0 37.0 37.0 37.0 54-55 35.7645 37.0 37.0 37.0 37.0 37.0 56-57 35.62675 37.0 37.0 37.0 37.0 37.0 58-59 35.63575 37.0 37.0 37.0 37.0 37.0 60-61 35.66225 37.0 37.0 37.0 37.0 37.0 62-63 35.62 37.0 37.0 37.0 37.0 37.0 64-65 35.7425 37.0 37.0 37.0 37.0 37.0 66-67 35.586749999999995 37.0 37.0 37.0 37.0 37.0 68-69 35.518 37.0 37.0 37.0 37.0 37.0 70-71 35.54 37.0 37.0 37.0 37.0 37.0 72-73 35.637 37.0 37.0 37.0 37.0 37.0 74-75 35.542249999999996 37.0 37.0 37.0 37.0 37.0 76-77 35.68325 37.0 37.0 37.0 37.0 37.0 78-79 35.667 37.0 37.0 37.0 37.0 37.0 80-81 35.62625 37.0 37.0 37.0 37.0 37.0 82-83 35.593 37.0 37.0 37.0 37.0 37.0 84-85 35.70283589647411 37.0 37.0 37.0 37.0 37.0 86-87 35.523089040141784 37.0 37.0 37.0 37.0 37.0 88-89 35.454340755566676 37.0 37.0 37.0 37.0 37.0 90-91 35.54991243432575 37.0 37.0 37.0 37.0 37.0 92-93 35.45609206905179 37.0 37.0 37.0 37.0 37.0 94-95 35.564423317488114 37.0 37.0 37.0 37.0 37.0 96-97 35.57751914537256 37.0 37.0 37.0 37.0 37.0 98-99 35.47301986146603 37.0 37.0 37.0 37.0 37.0 100-101 35.51578140456727 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 3.0 25 6.0 26 10.0 27 19.0 28 24.0 29 48.0 30 71.0 31 76.0 32 111.0 33 154.0 34 221.0 35 487.0 36 2140.0 37 626.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.525000000000002 12.575 17.675 40.225 2 22.7 22.2 31.2 23.9 3 25.775 23.25 23.05 27.925 4 27.925 27.6 18.625 25.85 5 29.099999999999998 28.825 20.575 21.5 6 23.925 31.900000000000002 20.200000000000003 23.974999999999998 7 20.375 17.224999999999998 37.05 25.35 8 24.025 22.1 24.7 29.175 9 22.45 21.125 27.474999999999998 28.95 10-11 25.775 27.725 20.9 25.6 12-13 23.599999999999998 21.762500000000003 26.6 28.037499999999998 14-15 23.5 23.799999999999997 25.35 27.35 16-17 25.3 23.799999999999997 23.35 27.55 18-19 24.5375 24.825 24.4125 26.224999999999998 20-21 25.374999999999996 23.775 24.6125 26.237500000000004 22-23 25.45 24.75 24.0375 25.7625 24-25 24.9875 24.025 24.025 26.9625 26-27 24.4 24.025 23.225 28.349999999999998 28-29 26.387500000000003 24.775 23.724999999999998 25.112499999999997 30-31 24.75 23.525 24.45 27.275 32-33 25.387500000000003 25.362499999999997 23.45 25.8 34-35 25.662499999999998 24.8625 23.45 26.025 36-37 24.712500000000002 23.6375 24.5625 27.0875 38-39 24.775 25.687500000000004 23.0 26.5375 40-41 26.375 23.325000000000003 23.849999999999998 26.450000000000003 42-43 25.275 25.025 23.474999999999998 26.224999999999998 44-45 24.575 24.8625 23.825 26.737499999999997 46-47 26.55 23.225 23.45 26.775 48-49 25.174999999999997 23.95 24.712500000000002 26.1625 50-51 25.025 23.7875 24.6875 26.5 52-53 25.275 23.45 23.3875 27.8875 54-55 24.975 23.849999999999998 24.1625 27.0125 56-57 25.525 24.525 23.6625 26.2875 58-59 25.074999999999996 24.25 23.2875 27.3875 60-61 26.2875 23.7125 23.474999999999998 26.525 62-63 24.775 23.875 25.0625 26.2875 64-65 26.0625 23.3 23.8875 26.75 66-67 24.75 25.1875 23.7125 26.35 68-69 24.875 24.2625 23.9875 26.875 70-71 25.95 23.525 23.3375 27.187499999999996 72-73 26.9625 23.65 23.2125 26.174999999999997 74-75 27.187499999999996 23.7875 23.025000000000002 26.0 76-77 26.900000000000002 23.525 23.3375 26.237500000000004 78-79 26.437500000000004 23.7 23.3625 26.5 80-81 26.1625 22.125 24.375 27.3375 82-83 26.8375 24.099999999999998 22.412499999999998 26.650000000000002 84-85 26.378297287160894 23.81547693461683 23.777972246530815 26.02825353169146 86-87 26.42901813633521 23.702313946216385 22.964352720450282 26.904315196998123 88-89 26.007005253940456 23.90542907180385 24.043032274205654 26.044533400050035 90-91 26.007005253940456 24.293219914936202 22.91718789091819 26.782586940205157 92-93 26.432324243182386 23.942957217913435 23.179884913685264 26.444833625218916 94-95 27.270452839629723 23.042281711283465 24.043032274205654 25.64423317488116 96-97 26.20180270405608 23.5227841762644 23.322483725588384 26.952929394091136 98-99 27.44375238337359 22.689716537434855 23.655777297572136 26.210753781619424 100-101 28.399122807017545 10.43233082706767 28.853383458646615 32.31516290726817 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 2.0 27 4.0 28 4.0 29 6.0 30 7.5 31 11.0 32 17.0 33 18.0 34 20.5 35 27.5 36 32.5 37 43.5 38 62.0 39 73.5 40 96.5 41 122.5 42 130.5 43 134.0 44 137.0 45 162.0 46 192.5 47 187.0 48 171.5 49 164.5 50 134.5 51 112.0 52 127.0 53 119.5 54 100.0 55 93.5 56 100.0 57 96.0 58 83.5 59 90.5 60 82.0 61 70.5 62 80.0 63 85.0 64 86.0 65 92.0 66 83.0 67 62.0 68 55.5 69 63.5 70 60.0 71 50.0 72 46.0 73 41.5 74 33.0 75 31.0 76 25.0 77 17.5 78 14.0 79 8.5 80 7.5 81 6.0 82 3.0 83 2.5 84 2.5 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 6.0 97 18.0 98 79.0 99 259.0 100 886.0 101 2749.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80597423951767 83.75 2 7.700739928747602 14.05 3 0.4110715264456015 1.125 4 0.027404768429706773 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027404768429706773 0.2 9 0.0 0.0 >10 0.027404768429706773 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 31 0.775 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 8 0.2 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0125 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285456 spots for SRR21853489.sra Written 285456 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra Read 285441 spots for SRR21853489.sra Written 285441 spots for SRR21853489.sra SRR ids: ['SRR21853489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r7mpmyg5 SRR21853489.sra spots: 5708835 blocks: [[1, 285441], [285442, 570882], [570883, 856323], [856324, 1141764], [1141765, 1427205], [1427206, 1712646], [1712647, 1998087], [1998088, 2283528], [2283529, 2568969], [2568970, 2854410], [2854411, 3139851], [3139852, 3425292], [3425293, 3710733], [3710734, 3996174], [3996175, 4281615], [4281616, 4567056], [4567057, 4852497], [4852498, 5137938], [5137939, 5423379], [5423380, 5708835]] SRR21853489 file size 1534561 SRR21853489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853489 SRR21853489_1.fastq Input file: SRR21853489_1.fastq trimmed: SRR21853489-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:05:32 2024 >> started Fri Dec 6 16:05:35 2024 >> done (2.958s) 5708835 reads processed; of these: 9 ( 0.00%) short reads filtered out after trimming by size control 57867 ( 1.01%) empty reads filtered out after trimming by size control 5650959 (98.99%) reads available; of these: 217 ( 0.00%) trimmed reads available after processing 5650742 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 3 0.00% 29 1 0.00% 30 1 0.00% 31 5 0.00% 32 4 0.00% 33 5 0.00% 34 0 0.00% 35 36 0.00% 36 33 0.00% 37 26 0.00% 38 40 0.00% 39 20 0.00% 40 27 0.00% 41 37 0.00% 42 25 0.00% 43 38 0.00% 44 23 0.00% 45 28 0.00% 46 18 0.00% 47 30 0.00% 48 33 0.00% 49 27 0.00% 50 34 0.00% 51 28 0.00% 52 32 0.00% 53 30 0.00% 54 33 0.00% 55 37 0.00% 56 37 0.00% 57 33 0.00% 58 41 0.00% 59 45 0.00% 60 37 0.00% 61 33 0.00% 62 51 0.00% 63 44 0.00% 64 37 0.00% 65 38 0.00% 66 52 0.00% 67 45 0.00% 68 56 0.00% 69 41 0.00% 70 55 0.00% 71 62 0.00% 72 64 0.00% 73 58 0.00% 74 53 0.00% 75 72 0.00% 76 53 0.00% 77 84 0.00% 78 68 0.00% 79 79 0.00% 80 69 0.00% 81 86 0.00% 82 68 0.00% 83 87 0.00% 84 97 0.00% 85 91 0.00% 86 116 0.00% 87 120 0.00% 88 104 0.00% 89 110 0.00% 90 155 0.00% 91 283 0.01% 92 171 0.00% 93 187 0.00% 94 429 0.01% 95 1541 0.03% 96 8070 0.14% 97 25598 0.45% 98 99053 1.75% 99 375557 6.65% 100 1251447 22.15% 101 3885621 68.76% 5650959 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=201.36 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=23.5 sequence=GCCGCCGCCGCC Started job on | Dec 06 16:05:57 Started mapping on | Dec 06 16:05:59 Finished on | Dec 06 16:06:09 Mapping speed, Million of reads per hour | 2034.35 Number of input reads | 5650959 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 5365044 Uniquely mapped reads % | 94.94% Average mapped length | 100.27 Number of splices: Total | 1774660 Number of splices: Annotated (sjdb) | 1680827 Number of splices: GT/AG | 1749840 Number of splices: GC/AG | 21888 Number of splices: AT/AC | 868 Number of splices: Non-canonical | 2064 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.68 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 136605 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 92467 % of reads mapped to too many loci | 1.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 149310 149310 149310 N_multimapping 136605 136605 136605 N_noFeature 217387 2773678 2734393 N_ambiguous 84689 5731 5177 UnstrandedReadsAssigned:5062968 PositiveStrandReadsAssigned:2585635 NegativeStrandReadsAssigned:2625474 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853489 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853489-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,650,959 reads, 5,214,297 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR21853489.ke.tsv 35125 SRR21853489.se.tsv 88098 total ==> SRR21853489.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 10.157 3.96542 PNS24247 1044 945 8.75 3.02571 PNS24249 1928 1829 35.5737 6.35573 PNS24246 1044 945 8.75 3.02571 PNS24248 1044 945 8.75 3.02571 PNS24244 1471 1372 30.0194 7.14987 PNS24243 293 194 8 13.4753 KQK14069 1603 1504 3690.69 801.881 KQK14071 474 375 458.802 399.801 ==> SRR21853489.se.tsv <== BRADI_1g14170v3 4482 BRADI_1g53295v3 30 BRADI_1g59795v3 117 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 541 BRADI_1g74790v3 29 BRADI_1g09890v3 1 BRADI_1g77505v3 85 BRADI_1g48960v3 0 SRR21853489 completed mapping pipeline successfully