Starting /dee2/code/volunteer_pipeline.sh SRR21853490 current disk space = 1550477889536 free memory = 1599393520 SRR21853490 SRAfilesize 797f1481a4a3e399317a94ef1eb7451f SRR21853490.sra SRR21853490.sra file validated SRR21853490 is single end SRR21853490 is conventional basespace SRR21853490 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.17675 37.0 37.0 37.0 25.0 37.0 2 34.8875 37.0 37.0 37.0 25.0 37.0 3 35.70225 37.0 37.0 37.0 37.0 37.0 4 35.79475 37.0 37.0 37.0 37.0 37.0 5 35.81525 37.0 37.0 37.0 37.0 37.0 6 35.93975 37.0 37.0 37.0 37.0 37.0 7 35.71225 37.0 37.0 37.0 37.0 37.0 8 36.00875 37.0 37.0 37.0 37.0 37.0 9 35.89675 37.0 37.0 37.0 37.0 37.0 10-11 35.960499999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.961749999999995 37.0 37.0 37.0 37.0 37.0 14-15 35.9105 37.0 37.0 37.0 37.0 37.0 16-17 35.980999999999995 37.0 37.0 37.0 37.0 37.0 18-19 35.89675 37.0 37.0 37.0 37.0 37.0 20-21 35.90775 37.0 37.0 37.0 37.0 37.0 22-23 35.78325 37.0 37.0 37.0 37.0 37.0 24-25 35.82725 37.0 37.0 37.0 37.0 37.0 26-27 35.688 37.0 37.0 37.0 37.0 37.0 28-29 35.619249999999994 37.0 37.0 37.0 37.0 37.0 30-31 35.6155 37.0 37.0 37.0 37.0 37.0 32-33 35.70875 37.0 37.0 37.0 37.0 37.0 34-35 35.707750000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.687265449086816 37.0 37.0 37.0 37.0 37.0 38-39 35.66374781085814 37.0 37.0 37.0 37.0 37.0 40-41 35.563737931075934 37.0 37.0 37.0 37.0 37.0 42-43 35.57757757757757 37.0 37.0 37.0 37.0 37.0 44-45 35.44094094094094 37.0 37.0 37.0 37.0 37.0 46-47 35.57657657657657 37.0 37.0 37.0 37.0 37.0 48-49 35.57532532532532 37.0 37.0 37.0 37.0 37.0 50-51 35.613767209011264 37.0 37.0 37.0 37.0 37.0 52-53 35.57672090112641 37.0 37.0 37.0 37.0 37.0 54-55 35.42978723404255 37.0 37.0 37.0 31.0 37.0 56-57 35.520901126408006 37.0 37.0 37.0 37.0 37.0 58-59 35.47259073842303 37.0 37.0 37.0 37.0 37.0 60-61 35.39374217772215 37.0 37.0 37.0 31.0 37.0 62-63 35.33491864831039 37.0 37.0 37.0 37.0 37.0 64-65 35.43103879849812 37.0 37.0 37.0 31.0 37.0 66-67 35.381727158948685 37.0 37.0 37.0 37.0 37.0 68-69 35.076595744680844 37.0 37.0 37.0 25.0 37.0 70-71 35.103379224030036 37.0 37.0 37.0 25.0 37.0 72-73 35.37571964956195 37.0 37.0 37.0 37.0 37.0 74-75 35.343679599499374 37.0 37.0 37.0 37.0 37.0 76-77 35.35850690930012 37.0 37.0 37.0 37.0 37.0 78-79 35.376564847270906 37.0 37.0 37.0 37.0 37.0 80-81 35.446419629444165 37.0 37.0 37.0 37.0 37.0 82-83 35.343515272909364 37.0 37.0 37.0 37.0 37.0 84-85 35.272658988482725 37.0 37.0 37.0 31.0 37.0 86-87 35.317225838758134 37.0 37.0 37.0 37.0 37.0 88-89 35.40385578367551 37.0 37.0 37.0 37.0 37.0 90-91 35.52128192288433 37.0 37.0 37.0 37.0 37.0 92-93 35.39243676433759 37.0 37.0 37.0 37.0 37.0 94-95 35.2717255196594 37.0 37.0 37.0 31.0 37.0 96-97 35.32121233842257 37.0 37.0 37.0 37.0 37.0 98-99 35.34991818892096 37.0 37.0 37.0 37.0 37.0 100-101 35.2643584993167 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 0.0 20 0.0 21 0.0 22 2.0 23 1.0 24 5.0 25 9.0 26 12.0 27 31.0 28 29.0 29 55.0 30 78.0 31 101.0 32 118.0 33 179.0 34 280.0 35 503.0 36 2077.0 37 515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.022516887665752 12.534400800600451 17.7633224918689 39.6797598198649 2 24.772727272727273 20.80808080808081 30.883838383838384 23.535353535353533 3 26.695021265949464 21.391043282461847 24.59344508381286 27.32049036777583 4 27.795846885163872 26.720040030022517 17.68826619964974 27.795846885163872 5 30.322742056542406 29.647235426569928 18.989241931448586 21.04078058543908 6 23.692769577182887 32.07405554165624 19.83987990993245 24.39329497122842 7 20.540405303977984 17.262947210407805 37.10282712034025 25.093820365273956 8 23.317488116087066 21.491118338754063 24.293219914936202 30.89817363022267 9 22.166624968726545 19.83987990993245 27.795846885163872 30.197648236177134 10-11 26.507380535401552 26.957718288716535 21.015761821366024 25.519139354515886 12-13 24.505879409557167 21.003252439329497 25.756817613209908 28.73405053790343 14-15 23.367525644233176 24.505879409557167 24.330748061045785 27.795846885163872 16-17 25.66925193895422 22.42932199149362 23.48011008256192 28.42131598699024 18-19 24.455841881411057 23.14235676757568 25.04378283712785 27.358018513885412 20-21 26.21966474856142 23.53014761070803 24.305729296972732 25.94445834375782 22-23 24.756067050287715 25.93194896172129 23.254941205904426 26.057042782086565 24-25 25.081310983237426 23.455091318488865 24.78108581436077 26.682511883912934 26-27 24.580935701776333 24.380785589191895 23.39254440830623 27.645734300725543 28-29 26.53239929947461 25.01876407305479 22.792094070552913 25.65674255691769 30-31 23.430072554415812 24.405804353264948 24.931198398799097 27.23292469352014 32-33 24.380785589191895 25.25644233174881 23.68026019514636 26.682511883912934 34-35 26.632474355766828 23.792844633475106 22.654490868151115 26.920190142606952 36-37 24.10557918438829 24.68101075806855 24.68101075806855 26.53239929947461 38-39 25.11883912934701 24.418313735301474 22.979734801100825 27.483112334250688 40-41 25.472288252220693 23.858376079069185 25.021894157387713 25.647441511322405 42-43 24.6996996996997 24.574574574574577 25.05005005005005 25.675675675675674 44-45 25.45045045045045 23.573573573573572 24.34934934934935 26.626626626626624 46-47 26.55155155155155 23.586086086086087 22.76026026026026 27.102102102102105 48-49 24.874874874874877 24.762262262262265 24.88738738738739 25.475475475475474 50-51 27.334167709637047 22.95369211514393 24.6433041301627 25.06883604505632 52-53 24.831038798498124 23.804755944931163 22.5657071339174 28.798498122653314 54-55 25.65707133917397 23.617021276595747 23.917396745932415 26.80851063829787 56-57 25.231539424280353 23.654568210262827 23.917396745932415 27.19649561952441 58-59 25.556946182728414 23.591989987484354 23.979974968710888 26.87108886107635 60-61 25.456821026282856 24.25531914893617 24.543178973717147 25.744680851063826 62-63 24.993742177722154 24.44305381727159 24.718397997496872 25.844806007509387 64-65 26.958698372966204 23.103879849812266 23.892365456821025 26.0450563204005 66-67 24.593241551939926 25.882352941176475 23.491864831038797 26.032540675844807 68-69 25.41927409261577 24.893617021276597 23.879849812265334 25.807259073842303 70-71 26.958698372966204 23.541927409261575 23.078848560700877 26.420525657071337 72-73 26.082603254067582 22.490613266583228 24.180225281602002 27.246558197747184 74-75 27.146433041301627 24.30538172715895 22.916145181476846 25.632040050062578 76-77 27.888346476405058 22.55601451996495 23.457253723870323 26.09838527975967 78-79 26.527290936404608 23.748122183274912 22.8592889334001 26.86529794692038 80-81 26.802704056084124 24.2864296444667 23.410115172759138 25.500751126690034 82-83 27.215823735603408 22.99699549323986 23.885828743114672 25.901352028042062 84-85 26.639959939909865 22.921882824236352 24.54932398597897 25.88883324987481 86-87 26.051577366049074 24.787180771156734 23.38507761642464 25.776164246369554 88-89 27.71657486229344 23.12218327491237 23.072108162243367 26.089133700550825 90-91 27.879318978467705 23.898347521281924 23.00951427140711 25.212819228843266 92-93 26.93463561232156 23.791635361883294 23.203105434510395 26.070623591284747 94-95 28.61257200100175 21.96343601302279 23.779113448534936 25.64487853744052 96-97 27.444834503510528 23.8716148445336 23.207121364092277 25.47642928786359 98-99 26.591284461948927 22.99580739423199 23.656460424342523 26.75644771947656 100-101 27.7517929529155 10.601808543810415 29.466791393826004 32.179607109448085 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 3.5 2 1.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 1.0 25 0.5 26 0.0 27 3.0 28 5.5 29 5.5 30 6.5 31 9.0 32 15.5 33 15.5 34 15.5 35 25.0 36 37.5 37 53.0 38 62.5 39 78.0 40 104.0 41 123.0 42 125.5 43 135.5 44 149.5 45 161.0 46 163.0 47 156.0 48 162.5 49 162.5 50 151.0 51 122.5 52 110.0 53 109.0 54 95.0 55 100.0 56 100.0 57 84.0 58 79.0 59 85.5 60 83.5 61 82.0 62 90.5 63 84.5 64 73.5 65 96.5 66 107.5 67 85.0 68 76.5 69 66.5 70 51.0 71 43.0 72 41.0 73 46.0 74 41.5 75 28.5 76 20.5 77 18.5 78 13.5 79 6.0 80 4.5 81 4.5 82 5.0 83 3.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 1.0 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-11 0.075 12-13 0.075 14-15 0.075 16-17 0.075 18-19 0.075 20-21 0.075 22-23 0.075 24-25 0.075 26-27 0.075 28-29 0.075 30-31 0.075 32-33 0.075 34-35 0.075 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 3.0 36-37 0.0 38-39 0.0 40-41 1.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 1.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 1.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 1.0 92-93 0.0 94-95 3.0 96-97 19.0 98-99 336.0 100-101 3635.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.67500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.74435461388347 81.375 2 8.698076386952886 15.6 3 0.5018120992472819 1.35 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05575689991636465 1.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 48 1.2 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 19 0.475 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835791 spots for SRR21853490.sra Written 835791 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra Read 835772 spots for SRR21853490.sra Written 835772 spots for SRR21853490.sra SRR ids: ['SRR21853490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vghdb85f SRR21853490.sra spots: 16715459 blocks: [[1, 835772], [835773, 1671544], [1671545, 2507316], [2507317, 3343088], [3343089, 4178860], [4178861, 5014632], [5014633, 5850404], [5850405, 6686176], [6686177, 7521948], [7521949, 8357720], [8357721, 9193492], [9193493, 10029264], [10029265, 10865036], [10865037, 11700808], [11700809, 12536580], [12536581, 13372352], [13372353, 14208124], [14208125, 15043896], [15043897, 15879668], [15879669, 16715459]] SRR21853490 file size 4501201 SRR21853490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853490 SRR21853490_1.fastq Input file: SRR21853490_1.fastq trimmed: SRR21853490-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:09:18 2024 >> started Fri Dec 6 16:09:26 2024 >> done (8.328s) 16715459 reads processed; of these: 29 ( 0.00%) short reads filtered out after trimming by size control 208029 ( 1.24%) empty reads filtered out after trimming by size control 16507401 (98.76%) reads available; of these: 489 ( 0.00%) trimmed reads available after processing 16506912 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 4 0.00% 22 4 0.00% 23 7 0.00% 24 11 0.00% 25 1 0.00% 26 5 0.00% 27 3 0.00% 28 11 0.00% 29 4 0.00% 30 7 0.00% 31 5 0.00% 32 14 0.00% 33 6 0.00% 34 9 0.00% 35 132 0.00% 36 141 0.00% 37 162 0.00% 38 138 0.00% 39 143 0.00% 40 155 0.00% 41 166 0.00% 42 161 0.00% 43 167 0.00% 44 159 0.00% 45 146 0.00% 46 141 0.00% 47 153 0.00% 48 160 0.00% 49 158 0.00% 50 194 0.00% 51 184 0.00% 52 187 0.00% 53 186 0.00% 54 172 0.00% 55 188 0.00% 56 193 0.00% 57 205 0.00% 58 224 0.00% 59 223 0.00% 60 225 0.00% 61 246 0.00% 62 224 0.00% 63 247 0.00% 64 237 0.00% 65 270 0.00% 66 294 0.00% 67 241 0.00% 68 295 0.00% 69 263 0.00% 70 256 0.00% 71 285 0.00% 72 269 0.00% 73 303 0.00% 74 320 0.00% 75 331 0.00% 76 365 0.00% 77 309 0.00% 78 334 0.00% 79 351 0.00% 80 388 0.00% 81 390 0.00% 82 407 0.00% 83 427 0.00% 84 450 0.00% 85 463 0.00% 86 509 0.00% 87 507 0.00% 88 488 0.00% 89 537 0.00% 90 684 0.00% 91 1041 0.01% 92 712 0.00% 93 782 0.00% 94 1523 0.01% 95 4704 0.03% 96 23148 0.14% 97 74563 0.45% 98 293289 1.78% 99 1101243 6.67% 100 3667004 22.21% 101 11324141 68.60% 16507401 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=22 prefix-density=0.37 prefix-fanout=1.8 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=198.41 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=23.5 sequence=GCCGCCGCCGCC Started job on | Dec 06 16:09:42 Started mapping on | Dec 06 16:09:42 Finished on | Dec 06 16:10:03 Mapping speed, Million of reads per hour | 2829.84 Number of input reads | 16507401 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 15676201 Uniquely mapped reads % | 94.96% Average mapped length | 100.24 Number of splices: Total | 5215547 Number of splices: Annotated (sjdb) | 4937571 Number of splices: GT/AG | 5141145 Number of splices: GC/AG | 64650 Number of splices: AT/AC | 2719 Number of splices: Non-canonical | 7033 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.00% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385103 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 249081 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446097 446097 446097 N_multimapping 385103 385103 385103 N_noFeature 637418 8078821 8018998 N_ambiguous 246167 16582 15369 UnstrandedReadsAssigned:14792616 PositiveStrandReadsAssigned:7580798 NegativeStrandReadsAssigned:7641834 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853490 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853490-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,507,401 reads, 15,225,330 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52973 SRR21853490.ke.tsv 35125 SRR21853490.se.tsv 88098 total ==> SRR21853490.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 6.46991 0.860404 PNS24247 1044 945 44.6378 5.25775 PNS24249 1928 1829 121.952 7.42174 PNS24246 1044 945 44.6378 5.25775 PNS24248 1044 945 44.6378 5.25775 PNS24244 1471 1372 11.6642 0.946306 PNS24243 293 194 23 13.1964 KQK14069 1603 1504 10857.1 803.516 KQK14071 474 375 1697.94 503.988 ==> SRR21853490.se.tsv <== BRADI_1g14170v3 13846 BRADI_1g53295v3 88 BRADI_1g59795v3 349 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 1659 BRADI_1g74790v3 69 BRADI_1g09890v3 2 BRADI_1g77505v3 243 BRADI_1g48960v3 0 SRR21853490 completed mapping pipeline successfully