Starting /dee2/code/volunteer_pipeline.sh SRR21853491 current disk space = 1550518071296 free memory = 1599887872 SRR21853491 SRAfilesize 2ab40c753bb2cecc90300a8f1fe9c5dd SRR21853491.sra SRR21853491.sra file validated SRR21853491 is single end SRR21853491 is conventional basespace SRR21853491 read1 length is 42-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 42-101 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.564 37.0 37.0 37.0 37.0 37.0 2 35.708 37.0 37.0 37.0 37.0 37.0 3 35.959 37.0 37.0 37.0 37.0 37.0 4 35.932 37.0 37.0 37.0 37.0 37.0 5 36.047 37.0 37.0 37.0 37.0 37.0 6 36.0525 37.0 37.0 37.0 37.0 37.0 7 35.9405 37.0 37.0 37.0 37.0 37.0 8 36.1545 37.0 37.0 37.0 37.0 37.0 9 35.9965 37.0 37.0 37.0 37.0 37.0 10-11 36.1005 37.0 37.0 37.0 37.0 37.0 12-13 36.02875 37.0 37.0 37.0 37.0 37.0 14-15 36.047 37.0 37.0 37.0 37.0 37.0 16-17 35.92975 37.0 37.0 37.0 37.0 37.0 18-19 36.044250000000005 37.0 37.0 37.0 37.0 37.0 20-21 36.01925 37.0 37.0 37.0 37.0 37.0 22-23 36.039249999999996 37.0 37.0 37.0 37.0 37.0 24-25 36.00575 37.0 37.0 37.0 37.0 37.0 26-27 35.83225 37.0 37.0 37.0 37.0 37.0 28-29 35.8335 37.0 37.0 37.0 37.0 37.0 30-31 35.821250000000006 37.0 37.0 37.0 37.0 37.0 32-33 35.83075 37.0 37.0 37.0 37.0 37.0 34-35 35.801 37.0 37.0 37.0 37.0 37.0 36-37 35.826750000000004 37.0 37.0 37.0 37.0 37.0 38-39 35.81525 37.0 37.0 37.0 37.0 37.0 40-41 35.8005 37.0 37.0 37.0 37.0 37.0 42-43 35.709853400850214 37.0 37.0 37.0 37.0 37.0 44-45 35.668917229307326 37.0 37.0 37.0 37.0 37.0 46-47 35.689422355588896 37.0 37.0 37.0 37.0 37.0 48-49 35.648412103025755 37.0 37.0 37.0 37.0 37.0 50-51 35.74468617154288 37.0 37.0 37.0 37.0 37.0 52-53 35.56439109777445 37.0 37.0 37.0 37.0 37.0 54-55 35.6479119779945 37.0 37.0 37.0 37.0 37.0 56-57 35.611152788197046 37.0 37.0 37.0 37.0 37.0 58-59 35.68867216804201 37.0 37.0 37.0 37.0 37.0 60-61 35.66516629157289 37.0 37.0 37.0 37.0 37.0 62-63 35.655413853463365 37.0 37.0 37.0 37.0 37.0 64-65 35.77219304826207 37.0 37.0 37.0 37.0 37.0 66-67 35.59139784946237 37.0 37.0 37.0 37.0 37.0 68-69 35.56089022255564 37.0 37.0 37.0 37.0 37.0 70-71 35.64591147786947 37.0 37.0 37.0 37.0 37.0 72-73 35.5198799699925 37.0 37.0 37.0 37.0 37.0 74-75 35.55588897224306 37.0 37.0 37.0 37.0 37.0 76-77 35.5743935983996 37.0 37.0 37.0 37.0 37.0 78-79 35.67791947986997 37.0 37.0 37.0 37.0 37.0 80-81 35.63315828957239 37.0 37.0 37.0 37.0 37.0 82-83 35.60290072518129 37.0 37.0 37.0 37.0 37.0 84-85 35.62265566391598 37.0 37.0 37.0 37.0 37.0 86-87 35.480620155038764 37.0 37.0 37.0 37.0 37.0 88-89 35.45511377844461 37.0 37.0 37.0 37.0 37.0 90-91 35.477369342335585 37.0 37.0 37.0 37.0 37.0 92-93 35.52619170300329 37.0 37.0 37.0 37.0 37.0 94-95 35.52357158063646 37.0 37.0 37.0 37.0 37.0 96-97 35.45640649745082 37.0 37.0 37.0 37.0 37.0 98-99 35.36026412182105 37.0 37.0 37.0 37.0 37.0 100-101 35.29755860961 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10-11 0.0 2101 12-13 0.0 2101 14-15 0.0 2101 16-17 0.0 2101 18-19 0.0 2101 20-21 0.0 2101 22-23 0.0 2101 24-25 0.0 2101 26-27 0.0 2101 28-29 0.0 2101 30-31 0.0 2101 32-33 0.0 2101 34-35 0.0 2101 36-37 0.0 2101 38-39 0.0 2101 40-41 0.0 2101 42-43 0.0 2101 44-45 0.0 2101 46-47 0.0 2101 48-49 0.0 2101 50-51 0.0 2101 52-53 0.0 2101 54-55 0.0 2101 56-57 0.0 2101 58-59 0.0 2101 60-61 0.0 2101 62-63 0.0 2101 64-65 0.0 2101 66-67 0.0 2101 68-69 0.0 2101 70-71 0.0 2101 72-73 0.0 2101 74-75 0.0 2101 76-77 0.0 2101 78-79 0.0 2101 80-81 0.0 2101 82-83 0.0 2101 84-85 0.0 2101 86-87 0.0 2101 88-89 0.0 2101 90-91 0.0 2101 92-93 0.0 2101 94-95 0.0 2101 96-97 0.0 2101 98-99 0.0 2101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 3.0 25 3.0 26 16.0 27 20.0 28 34.0 29 44.0 30 60.0 31 80.0 32 126.0 33 169.0 34 239.0 35 444.0 36 2157.0 37 602.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.125 13.475000000000001 16.475 40.925 2 25.775 19.125 29.575000000000003 25.525 3 26.924999999999997 22.7 22.15 28.225 4 28.125 27.85 17.7 26.325 5 29.849999999999998 29.525000000000002 19.225 21.4 6 22.3 31.3 19.125 27.275 7 21.375 15.675 37.225 25.724999999999998 8 22.775000000000002 21.625 24.75 30.85 9 22.575 20.150000000000002 26.450000000000003 30.825000000000003 10-11 26.974999999999998 26.8375 19.5 26.687499999999996 12-13 24.85 21.9 24.099999999999998 29.15 14-15 25.05 23.599999999999998 24.5625 26.787499999999998 16-17 26.637499999999996 23.5 23.325000000000003 26.5375 18-19 24.625 23.974999999999998 23.375 28.025 20-21 26.55 23.0625 23.400000000000002 26.987499999999997 22-23 25.900000000000002 23.4875 22.35 28.262500000000003 24-25 25.4625 23.2125 23.925 27.400000000000002 26-27 25.900000000000002 24.075 22.412499999999998 27.6125 28-29 26.5375 23.150000000000002 23.0125 27.3 30-31 25.35 22.3375 23.7625 28.549999999999997 32-33 26.1625 22.825 23.599999999999998 27.4125 34-35 26.1625 23.6625 23.0 27.175 36-37 25.7125 22.7125 22.8875 28.6875 38-39 26.2875 22.95 22.775000000000002 27.987499999999997 40-41 25.374999999999996 23.6625 23.3375 27.625 42-43 25.87823477934742 23.090386298287285 24.00300037504688 27.028378547318415 44-45 25.668917229307326 23.030757689422355 23.36834208552138 27.93198299574894 46-47 26.106526631657918 24.081020255063766 22.13053263315829 27.68192048012003 48-49 25.93148287071768 23.13078269567392 23.055763940985248 27.881970492623154 50-51 27.019254813703427 23.355838959739934 21.880470117529384 27.74443610902726 52-53 25.84396099024756 22.718179544886222 22.418104526131533 29.019754938734682 54-55 25.343835958989747 23.55588897224306 22.643160790197552 28.457114278569644 56-57 26.25656414103526 23.193298324581146 23.330832708177045 27.219304826206553 58-59 26.231557889472366 22.343085771442862 22.605651412853213 28.81970492623156 60-61 26.19404851212803 23.068267066766694 23.118279569892472 27.619404851212803 62-63 26.906726681670417 22.58064516129032 23.15578894723681 27.35683920980245 64-65 26.60665166291573 22.36809202300575 23.593398349587396 27.431857964491122 66-67 26.16904226056514 22.73068267066767 22.85571392848212 28.244561140285075 68-69 25.98149537384346 23.63090772693173 23.143285821455365 27.24431107776944 70-71 26.38159539884971 22.280570142535634 21.892973243310827 29.444861215303824 72-73 25.743935983995996 23.005751437859466 23.568392098024507 27.68192048012003 74-75 27.169292323080768 23.980995248812203 22.168042010502624 26.6816704176044 76-77 26.79419854963741 22.280570142535634 23.43085771442861 27.494373593398347 78-79 27.169292323080768 23.143285821455365 22.643160790197552 27.04426106526632 80-81 27.806951737934483 22.61815453863466 22.73068267066767 26.84421105276319 82-83 27.231807951987996 23.10577644411103 23.15578894723681 26.506626656664167 84-85 26.86921730432608 22.655663915978995 22.393098274568644 28.08202050512628 86-87 26.36909227306827 23.78094523630908 22.55563890972743 27.294323580895224 88-89 27.25681420355089 22.305576394098527 22.468117029257314 27.969492373093274 90-91 26.16904226056514 23.080770192548137 22.83070767691923 27.91947986996749 92-93 27.172689758659494 22.44591721895711 22.746029761160436 27.635363261222956 94-95 27.292057535959973 22.088805503439648 22.263914946841776 28.355222013758596 96-97 26.224170319348776 23.519098309329994 22.93049467752035 27.326236693800876 98-99 28.484076433121018 21.29936305732484 22.4968152866242 27.719745222929937 100-101 29.695074276778733 9.523064894448789 27.52150117279124 33.26035965598123 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.5 3 1.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.5 25 1.5 26 2.0 27 3.5 28 7.0 29 7.5 30 8.0 31 11.5 32 10.5 33 10.0 34 16.0 35 22.5 36 37.0 37 52.5 38 56.0 39 58.0 40 71.5 41 101.5 42 126.0 43 130.0 44 142.0 45 147.5 46 139.5 47 141.0 48 140.5 49 126.0 50 114.0 51 121.0 52 118.5 53 106.0 54 96.0 55 94.5 56 97.0 57 96.0 58 89.0 59 85.0 60 96.5 61 95.0 62 88.0 63 93.5 64 94.0 65 90.0 66 84.0 67 86.0 68 97.5 69 99.5 70 87.0 71 75.5 72 64.0 73 59.5 74 56.5 75 37.0 76 30.0 77 26.0 78 13.5 79 11.5 80 10.5 81 7.0 82 6.0 83 2.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 1.0 94-95 1.0 96-97 33.0 98-99 348.0 100-101 3616.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.73561946902655 82.025 2 8.241150442477876 14.899999999999999 3 0.8849557522123894 2.4 4 0.05530973451327434 0.2 5 0.05530973451327434 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02765486725663717 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 2 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra Read 231240 spots for SRR21853491.sra Written 231240 spots for SRR21853491.sra SRR ids: ['SRR21853491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jq60tec1 SRR21853491.sra spots: 4624800 blocks: [[1, 231240], [231241, 462480], [462481, 693720], [693721, 924960], [924961, 1156200], [1156201, 1387440], [1387441, 1618680], [1618681, 1849920], [1849921, 2081160], [2081161, 2312400], [2312401, 2543640], [2543641, 2774880], [2774881, 3006120], [3006121, 3237360], [3237361, 3468600], [3468601, 3699840], [3699841, 3931080], [3931081, 4162320], [4162321, 4393560], [4393561, 4624800]] SRR21853491 file size 1243163 SRR21853491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853491 SRR21853491_1.fastq Input file: SRR21853491_1.fastq trimmed: SRR21853491-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:09:18 2024 >> started Fri Dec 6 16:09:20 2024 >> done (2.649s) 4624800 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 23998 ( 0.52%) empty reads filtered out after trimming by size control 4600801 (99.48%) reads available; of these: 175 ( 0.00%) trimmed reads available after processing 4600626 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 0 0.00% 29 0 0.00% 30 3 0.00% 31 4 0.00% 32 4 0.00% 33 9 0.00% 34 2 0.00% 35 10 0.00% 36 10 0.00% 37 12 0.00% 38 17 0.00% 39 14 0.00% 40 16 0.00% 41 12 0.00% 42 16 0.00% 43 18 0.00% 44 13 0.00% 45 15 0.00% 46 18 0.00% 47 10 0.00% 48 7 0.00% 49 26 0.00% 50 11 0.00% 51 12 0.00% 52 20 0.00% 53 16 0.00% 54 25 0.00% 55 20 0.00% 56 15 0.00% 57 15 0.00% 58 18 0.00% 59 24 0.00% 60 21 0.00% 61 34 0.00% 62 27 0.00% 63 27 0.00% 64 32 0.00% 65 19 0.00% 66 25 0.00% 67 23 0.00% 68 21 0.00% 69 27 0.00% 70 27 0.00% 71 28 0.00% 72 31 0.00% 73 27 0.00% 74 32 0.00% 75 32 0.00% 76 43 0.00% 77 28 0.00% 78 37 0.00% 79 36 0.00% 80 36 0.00% 81 44 0.00% 82 46 0.00% 83 47 0.00% 84 39 0.00% 85 49 0.00% 86 46 0.00% 87 63 0.00% 88 57 0.00% 89 65 0.00% 90 79 0.00% 91 188 0.00% 92 79 0.00% 93 121 0.00% 94 280 0.01% 95 1211 0.03% 96 6517 0.14% 97 19755 0.43% 98 78000 1.70% 99 303062 6.59% 100 987565 21.47% 101 3202458 69.61% 4600801 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=210.99 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=23.7 sequence=GCCGCCGCCGCC Started job on | Dec 06 16:09:36 Started mapping on | Dec 06 16:09:36 Finished on | Dec 06 16:09:44 Mapping speed, Million of reads per hour | 2070.36 Number of input reads | 4600801 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 4391918 Uniquely mapped reads % | 95.46% Average mapped length | 100.30 Number of splices: Total | 1376216 Number of splices: Annotated (sjdb) | 1303736 Number of splices: GT/AG | 1356959 Number of splices: GC/AG | 16925 Number of splices: AT/AC | 679 Number of splices: Non-canonical | 1653 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99977 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 64080 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 108906 108906 108906 N_multimapping 99977 99977 99977 N_noFeature 164522 2270074 2227056 N_ambiguous 68144 5293 4007 UnstrandedReadsAssigned:4159252 PositiveStrandReadsAssigned:2116551 NegativeStrandReadsAssigned:2160855 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853491 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853491-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,600,801 reads, 4,270,234 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 SRR21853491.ke.tsv 35125 SRR21853491.se.tsv 88098 total ==> SRR21853491.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 11.3125 5.23143 PNS24247 1044 945 11.6667 4.77862 PNS24249 1928 1829 62.6875 13.2664 PNS24246 1044 945 11.6667 4.77862 PNS24248 1044 945 11.6667 4.77862 PNS24244 1471 1372 0 0 PNS24243 293 194 6 11.9712 KQK14069 1603 1504 3938.79 1013.68 KQK14071 474 375 428.383 442.169 ==> SRR21853491.se.tsv <== BRADI_1g14170v3 4680 BRADI_1g53295v3 19 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 331 BRADI_1g74790v3 22 BRADI_1g09890v3 1 BRADI_1g77505v3 65 BRADI_1g48960v3 0 SRR21853491 completed mapping pipeline successfully