Starting /dee2/code/volunteer_pipeline.sh SRR21853492 current disk space = 1550537822208 free memory = 1599883464 SRR21853492 SRAfilesize 044c630b509fd70a9aae982616c5b393 SRR21853492.sra SRR21853492.sra file validated SRR21853492 is single end SRR21853492 is conventional basespace SRR21853492 read1 length is 56-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853492_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 56-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.154 37.0 37.0 37.0 25.0 37.0 2 34.84025 37.0 37.0 37.0 25.0 37.0 3 35.701 37.0 37.0 37.0 37.0 37.0 4 35.736 37.0 37.0 37.0 37.0 37.0 5 35.746 37.0 37.0 37.0 37.0 37.0 6 35.7905 37.0 37.0 37.0 37.0 37.0 7 35.6625 37.0 37.0 37.0 37.0 37.0 8 35.7855 37.0 37.0 37.0 37.0 37.0 9 35.7785 37.0 37.0 37.0 37.0 37.0 10-11 35.929500000000004 37.0 37.0 37.0 37.0 37.0 12-13 35.8675 37.0 37.0 37.0 37.0 37.0 14-15 35.87875 37.0 37.0 37.0 37.0 37.0 16-17 35.81425 37.0 37.0 37.0 37.0 37.0 18-19 35.90975 37.0 37.0 37.0 37.0 37.0 20-21 35.8655 37.0 37.0 37.0 37.0 37.0 22-23 35.835750000000004 37.0 37.0 37.0 37.0 37.0 24-25 35.831 37.0 37.0 37.0 37.0 37.0 26-27 35.66975 37.0 37.0 37.0 37.0 37.0 28-29 35.692750000000004 37.0 37.0 37.0 37.0 37.0 30-31 35.692 37.0 37.0 37.0 37.0 37.0 32-33 35.6105 37.0 37.0 37.0 37.0 37.0 34-35 35.764250000000004 37.0 37.0 37.0 37.0 37.0 36-37 35.63875 37.0 37.0 37.0 37.0 37.0 38-39 35.69225 37.0 37.0 37.0 37.0 37.0 40-41 35.57475 37.0 37.0 37.0 37.0 37.0 42-43 35.57525 37.0 37.0 37.0 37.0 37.0 44-45 35.4375 37.0 37.0 37.0 37.0 37.0 46-47 35.552 37.0 37.0 37.0 37.0 37.0 48-49 35.47775 37.0 37.0 37.0 37.0 37.0 50-51 35.5835 37.0 37.0 37.0 37.0 37.0 52-53 35.582 37.0 37.0 37.0 37.0 37.0 54-55 35.549499999999995 37.0 37.0 37.0 37.0 37.0 56-57 35.41030676419105 37.0 37.0 37.0 37.0 37.0 58-59 35.43560890222555 37.0 37.0 37.0 37.0 37.0 60-61 35.375843960990245 37.0 37.0 37.0 37.0 37.0 62-63 35.36109027256814 37.0 37.0 37.0 37.0 37.0 64-65 35.348837209302324 37.0 37.0 37.0 37.0 37.0 66-67 35.386096524131034 37.0 37.0 37.0 37.0 37.0 68-69 35.294323580895224 37.0 37.0 37.0 37.0 37.0 70-71 35.37709427356839 37.0 37.0 37.0 37.0 37.0 72-73 35.38159539884971 37.0 37.0 37.0 37.0 37.0 74-75 35.34908727181795 37.0 37.0 37.0 37.0 37.0 76-77 35.202550637659414 37.0 37.0 37.0 31.0 37.0 78-79 35.26156539134784 37.0 37.0 37.0 31.0 37.0 80-81 35.29582395598899 37.0 37.0 37.0 37.0 37.0 82-83 35.344086021505376 37.0 37.0 37.0 37.0 37.0 84-85 35.3105776444111 37.0 37.0 37.0 37.0 37.0 86-87 35.37884471117779 37.0 37.0 37.0 31.0 37.0 88-89 35.38909727431857 37.0 37.0 37.0 37.0 37.0 90-91 35.372093023255815 37.0 37.0 37.0 37.0 37.0 92-93 35.288822205551384 37.0 37.0 37.0 37.0 37.0 94-95 35.24781195298824 37.0 37.0 37.0 31.0 37.0 96-97 35.22534452831606 37.0 37.0 37.0 31.0 37.0 98-99 35.16373725513951 37.0 37.0 37.0 31.0 37.0 100-101 35.242445038659085 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 5.0 23 1.0 24 3.0 25 11.0 26 21.0 27 18.0 28 33.0 29 52.0 30 82.0 31 106.0 32 130.0 33 190.0 34 265.0 35 481.0 36 2116.0 37 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.325000000000003 11.924999999999999 17.8 40.949999999999996 2 25.915635261429653 17.93382167213943 31.573629704470825 24.57691336196009 3 26.450000000000003 22.35 23.150000000000002 28.050000000000004 4 27.85 27.775 18.175 26.200000000000003 5 28.999999999999996 29.15 18.725 23.125 6 22.275 32.875 20.8 24.05 7 20.375 15.55 38.550000000000004 25.525 8 22.875 20.974999999999998 23.45 32.7 9 22.95 20.775 27.250000000000004 29.025000000000002 10-11 26.737499999999997 26.174999999999997 19.525000000000002 27.5625 12-13 23.9125 20.9 24.4875 30.7 14-15 25.424999999999997 23.0 24.2375 27.3375 16-17 26.1 23.2125 23.0375 27.650000000000002 18-19 25.95 23.65 23.2125 27.187499999999996 20-21 25.7125 23.799999999999997 23.4125 27.075 22-23 25.900000000000002 23.075000000000003 24.425 26.6 24-25 25.5375 23.200000000000003 23.65 27.6125 26-27 25.35 23.7 23.575 27.375 28-29 26.2875 23.075000000000003 23.425 27.212500000000002 30-31 25.5125 24.212500000000002 23.375 26.900000000000002 32-33 25.5625 24.4 23.775 26.2625 34-35 26.2875 23.45 22.400000000000002 27.8625 36-37 25.424999999999997 23.549999999999997 23.6625 27.3625 38-39 26.137500000000003 23.724999999999998 23.150000000000002 26.987499999999997 40-41 26.137500000000003 22.425 24.224999999999998 27.212500000000002 42-43 26.1625 23.35 22.787499999999998 27.700000000000003 44-45 25.6125 23.45 22.912499999999998 28.025 46-47 27.2625 23.549999999999997 22.7125 26.474999999999998 48-49 27.0125 22.537499999999998 22.8875 27.5625 50-51 26.674999999999997 23.625 23.05 26.650000000000002 52-53 26.674999999999997 22.8375 22.35 28.1375 54-55 26.424999999999997 22.85 22.975 27.750000000000004 56-57 26.753344168021005 22.90286285785723 22.490311288911112 27.853481685210653 58-59 25.418854713678417 22.980745186296573 23.980995248812203 27.619404851212803 60-61 26.11902975743936 23.280820205051263 23.568392098024507 27.031757939484873 62-63 25.818954738684667 23.305826456614152 22.330582645661416 28.54463615903976 64-65 26.906726681670417 22.31807951987997 22.843210802700675 27.93198299574894 66-67 25.006251562890725 24.36859214803701 22.88072018004501 27.74443610902726 68-69 26.469117279319832 23.268317079269817 23.48087021755439 26.78169542385596 70-71 26.731682920730183 22.780695173793447 23.068267066766694 27.419354838709676 72-73 26.819204801200303 22.455613903475868 23.380845211302827 27.344336084021002 74-75 27.25681420355089 23.443360840210055 22.918229557389346 26.38159539884971 76-77 26.85671417854464 22.43060765191298 23.055763940985248 27.656914228557138 78-79 26.906726681670417 22.593148287071767 23.068267066766694 27.431857964491122 80-81 25.943985996499126 23.593398349587396 23.34333583395849 27.11927981995499 82-83 25.468867216804203 23.443360840210055 23.080770192548137 28.00700175043761 84-85 27.631907976994246 22.643160790197552 23.005751437859466 26.71917979494874 86-87 26.456614153538382 23.643410852713178 22.48062015503876 27.419354838709676 88-89 26.219054763690924 23.48087021755439 22.643160790197552 27.656914228557138 90-91 25.98149537384346 22.643160790197552 23.268317079269817 28.107026756689173 92-93 27.069267316829208 22.85571392848212 22.9057264316079 27.169292323080768 94-95 26.744186046511626 22.343085771442862 23.068267066766694 27.84446111527882 96-97 27.478718077115673 21.482223335002505 23.83575363044567 27.203304957436153 98-99 26.95773575326818 21.182891229851503 23.30244954943521 28.556923467445106 100-101 29.27436935534102 10.214886328246651 27.6393646838991 32.87137963251324 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 2.0 28 4.0 29 5.0 30 3.0 31 4.0 32 11.0 33 15.5 34 15.5 35 27.0 36 41.0 37 44.5 38 53.5 39 56.0 40 76.0 41 108.5 42 117.0 43 128.5 44 142.0 45 146.5 46 145.5 47 156.0 48 165.5 49 152.5 50 128.5 51 120.0 52 114.5 53 109.0 54 109.0 55 94.5 56 88.0 57 93.5 58 100.0 59 97.0 60 91.0 61 86.5 62 84.0 63 91.0 64 93.0 65 90.5 66 81.0 67 79.5 68 81.5 69 80.5 70 85.5 71 77.5 72 55.5 73 49.0 74 49.5 75 38.0 76 28.5 77 22.5 78 18.5 79 12.5 80 8.5 81 6.0 82 4.5 83 3.5 84 1.5 85 0.5 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.0250000000000001 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 2.0 96 6.0 97 11.0 98 81.0 99 253.0 100 870.0 101 2776.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.03056768558952 84.3 2 7.232532751091703 13.25 3 0.6550218340611353 1.7999999999999998 4 0.02729257641921397 0.1 5 0.02729257641921397 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02729257641921397 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 2 (97% over 37bp) GATCGATCGATCGATTTGATGATGCCTTTAGTGGAACTTGAGGCTGGTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra Read 785965 spots for SRR21853492.sra Written 785965 spots for SRR21853492.sra SRR ids: ['SRR21853492.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5juyg78j SRR21853492.sra spots: 15719300 blocks: [[1, 785965], [785966, 1571930], [1571931, 2357895], [2357896, 3143860], [3143861, 3929825], [3929826, 4715790], [4715791, 5501755], [5501756, 6287720], [6287721, 7073685], [7073686, 7859650], [7859651, 8645615], [8645616, 9431580], [9431581, 10217545], [10217546, 11003510], [11003511, 11789475], [11789476, 12575440], [12575441, 13361405], [13361406, 14147370], [14147371, 14933335], [14933336, 15719300]] SRR21853492 file size 4233169 SRR21853492 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853492 SRR21853492_1.fastq Input file: SRR21853492_1.fastq trimmed: SRR21853492-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:10:01 2024 >> started Fri Dec 6 16:10:13 2024 >> done (12.180s) 15719300 reads processed; of these: 21 ( 0.00%) short reads filtered out after trimming by size control 100612 ( 0.64%) empty reads filtered out after trimming by size control 15618667 (99.36%) reads available; of these: 451 ( 0.00%) trimmed reads available after processing 15618216 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 6 0.00% 23 1 0.00% 24 1 0.00% 25 7 0.00% 26 3 0.00% 27 7 0.00% 28 9 0.00% 29 5 0.00% 30 5 0.00% 31 5 0.00% 32 13 0.00% 33 4 0.00% 34 9 0.00% 35 114 0.00% 36 94 0.00% 37 88 0.00% 38 98 0.00% 39 99 0.00% 40 109 0.00% 41 100 0.00% 42 111 0.00% 43 102 0.00% 44 93 0.00% 45 134 0.00% 46 105 0.00% 47 115 0.00% 48 117 0.00% 49 147 0.00% 50 120 0.00% 51 131 0.00% 52 130 0.00% 53 158 0.00% 54 149 0.00% 55 137 0.00% 56 145 0.00% 57 143 0.00% 58 148 0.00% 59 143 0.00% 60 153 0.00% 61 178 0.00% 62 142 0.00% 63 159 0.00% 64 190 0.00% 65 156 0.00% 66 176 0.00% 67 188 0.00% 68 176 0.00% 69 173 0.00% 70 184 0.00% 71 224 0.00% 72 188 0.00% 73 185 0.00% 74 182 0.00% 75 172 0.00% 76 190 0.00% 77 226 0.00% 78 237 0.00% 79 215 0.00% 80 223 0.00% 81 282 0.00% 82 238 0.00% 83 255 0.00% 84 265 0.00% 85 285 0.00% 86 277 0.00% 87 323 0.00% 88 307 0.00% 89 331 0.00% 90 400 0.00% 91 742 0.00% 92 389 0.00% 93 523 0.00% 94 1251 0.01% 95 4363 0.03% 96 21649 0.14% 97 67107 0.43% 98 265691 1.70% 99 1034762 6.63% 100 3359477 21.51% 101 10852719 69.49% 15618667 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=210.65 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=24.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 16:10:30 Started mapping on | Dec 06 16:10:30 Finished on | Dec 06 16:11:06 Mapping speed, Million of reads per hour | 1561.87 Number of input reads | 15618667 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 14896100 Uniquely mapped reads % | 95.37% Average mapped length | 100.27 Number of splices: Total | 4711491 Number of splices: Annotated (sjdb) | 4462113 Number of splices: GT/AG | 4644552 Number of splices: GC/AG | 58305 Number of splices: AT/AC | 2339 Number of splices: Non-canonical | 6295 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.75 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345233 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 209250 % of reads mapped to too many loci | 1.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.87% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 377334 377334 377334 N_multimapping 345233 345233 345233 N_noFeature 560104 7694486 7561469 N_ambiguous 230199 17800 13875 UnstrandedReadsAssigned:14105797 PositiveStrandReadsAssigned:7183814 NegativeStrandReadsAssigned:7320756 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853492 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853492-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,618,667 reads, 14,479,008 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52973 SRR21853492.ke.tsv 35125 SRR21853492.se.tsv 88098 total ==> SRR21853492.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 76.2356 10.3746 PNS24247 1044 945 22.739 2.74081 PNS24249 1928 1829 175.368 10.9213 PNS24246 1044 945 22.739 2.74081 PNS24248 1044 945 22.739 2.74081 PNS24244 1471 1372 18.179 1.50923 PNS24243 293 194 26 15.2655 KQK14069 1603 1504 13042.7 987.778 KQK14071 474 375 1705.44 518.017 ==> SRR21853492.se.tsv <== BRADI_1g14170v3 16241 BRADI_1g53295v3 73 BRADI_1g59795v3 319 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 1130 BRADI_1g74790v3 66 BRADI_1g09890v3 13 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR21853492 completed mapping pipeline successfully