Starting /dee2/code/volunteer_pipeline.sh SRR21853493 current disk space = 1550462050304 free memory = 1596746244 SRR21853493 SRAfilesize 1c070bdefefce32845d804567e6bae18 SRR21853493.sra SRR21853493.sra file validated SRR21853493 is single end SRR21853493 is conventional basespace SRR21853493 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.49525 37.0 37.0 37.0 37.0 37.0 2 34.814 37.0 37.0 37.0 25.0 37.0 3 35.85025 37.0 37.0 37.0 37.0 37.0 4 35.82475 37.0 37.0 37.0 37.0 37.0 5 35.95825 37.0 37.0 37.0 37.0 37.0 6 35.94925 37.0 37.0 37.0 37.0 37.0 7 35.74075 37.0 37.0 37.0 37.0 37.0 8 36.01225 37.0 37.0 37.0 37.0 37.0 9 35.99675 37.0 37.0 37.0 37.0 37.0 10-11 36.01349999999999 37.0 37.0 37.0 37.0 37.0 12-13 36.03875 37.0 37.0 37.0 37.0 37.0 14-15 35.991 37.0 37.0 37.0 37.0 37.0 16-17 36.037 37.0 37.0 37.0 37.0 37.0 18-19 36.048249999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.947 37.0 37.0 37.0 37.0 37.0 22-23 35.93175 37.0 37.0 37.0 37.0 37.0 24-25 35.88875 37.0 37.0 37.0 37.0 37.0 26-27 35.919250000000005 37.0 37.0 37.0 37.0 37.0 28-29 35.79525 37.0 37.0 37.0 37.0 37.0 30-31 35.80325 37.0 37.0 37.0 37.0 37.0 32-33 35.7355 37.0 37.0 37.0 37.0 37.0 34-35 35.804249999999996 37.0 37.0 37.0 37.0 37.0 36-37 35.809202300575144 37.0 37.0 37.0 37.0 37.0 38-39 35.792948237059264 37.0 37.0 37.0 37.0 37.0 40-41 35.66841710427607 37.0 37.0 37.0 37.0 37.0 42-43 35.722430607651916 37.0 37.0 37.0 37.0 37.0 44-45 35.678669667416855 37.0 37.0 37.0 37.0 37.0 46-47 35.74318579644911 37.0 37.0 37.0 37.0 37.0 48-49 35.64441110277569 37.0 37.0 37.0 37.0 37.0 50-51 35.723930982745685 37.0 37.0 37.0 37.0 37.0 52-53 35.63190797699425 37.0 37.0 37.0 37.0 37.0 54-55 35.791947986996746 37.0 37.0 37.0 37.0 37.0 56-57 35.64216054013504 37.0 37.0 37.0 37.0 37.0 58-59 35.56814203550888 37.0 37.0 37.0 37.0 37.0 60-61 35.64841210302576 37.0 37.0 37.0 37.0 37.0 62-63 35.56989247311828 37.0 37.0 37.0 37.0 37.0 64-65 35.566891722930734 37.0 37.0 37.0 37.0 37.0 66-67 35.61890472618154 37.0 37.0 37.0 37.0 37.0 68-69 35.4316079019755 37.0 37.0 37.0 37.0 37.0 70-71 35.40360090022506 37.0 37.0 37.0 37.0 37.0 72-73 35.54013503375844 37.0 37.0 37.0 37.0 37.0 74-75 35.500250125062536 37.0 37.0 37.0 37.0 37.0 76-77 35.420315236427314 37.0 37.0 37.0 37.0 37.0 78-79 35.46591324875038 37.0 37.0 37.0 37.0 37.0 80-81 35.52402402402402 37.0 37.0 37.0 37.0 37.0 82-83 35.43718718718719 37.0 37.0 37.0 37.0 37.0 84-85 35.27923866766842 37.0 37.0 37.0 31.0 37.0 86-87 35.459554219884794 37.0 37.0 37.0 37.0 37.0 88-89 35.39318807913849 37.0 37.0 37.0 37.0 37.0 90-91 35.477585775106434 37.0 37.0 37.0 37.0 37.0 92-93 35.406461307287756 37.0 37.0 37.0 37.0 37.0 94-95 35.28055135073198 37.0 37.0 37.0 37.0 37.0 96-97 35.3904111512209 37.0 37.0 37.0 37.0 37.0 98-99 35.313803325707475 37.0 37.0 37.0 37.0 37.0 100-101 35.20272718093453 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 4.0 23 1.0 24 7.0 25 11.0 26 21.0 27 15.0 28 28.0 29 51.0 30 58.0 31 73.0 32 117.0 33 191.0 34 224.0 35 463.0 36 2191.0 37 541.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.781945486371594 15.353838459614904 20.905226306576644 35.95898974743686 2 22.225050916496944 21.69042769857434 35.28513238289206 20.799389002036662 3 25.006251562890725 25.28132033008252 25.881470367591895 23.830957739434858 4 25.63140785196299 30.457614403600903 19.529882470617654 24.381095273818453 5 26.431607901975497 32.65816454113528 22.005501375343837 18.904726181545385 6 19.679919979995 35.15878969742436 22.58064516129032 22.58064516129032 7 18.529632408102024 17.854463615903978 40.36009002250563 23.25581395348837 8 21.630407601900476 22.55563890972743 25.881470367591895 29.932483120780194 9 21.13028257064266 21.655413853463365 30.332583145786447 26.881720430107524 10-11 25.206301575393848 28.80720180045011 22.093023255813954 23.893473368342086 12-13 22.1055263815954 23.88097024256064 28.219554888722183 25.79394848712178 14-15 23.655913978494624 24.99374843710928 27.156789197299325 24.193548387096776 16-17 23.668417104276067 25.84396099024756 27.181795448862218 23.305826456614152 18-19 23.593398349587396 25.63140785196299 26.419104776194047 24.356089022255563 20-21 23.168292073018254 25.893973493373345 27.169292323080768 23.768442110527634 22-23 23.080770192548137 26.65666416604151 26.25656414103526 24.006001500375092 24-25 24.23105776444111 26.581645411352838 26.356589147286826 22.83070767691923 26-27 23.80595148787197 25.893973493373345 25.381345336334082 24.918729682420604 28-29 23.618404601150285 26.431607901975497 26.456614153538382 23.493373343335833 30-31 23.005751437859466 25.64391097774444 27.731932983245812 23.618404601150285 32-33 22.9057264316079 27.569392348087025 26.431607901975497 23.093273318329583 34-35 24.20605151287822 25.98149537384346 25.256314078519633 24.55613903475869 36-37 23.243310827706924 25.693923480870218 27.394348587146787 23.668417104276067 38-39 24.06851712928232 26.619154788697173 25.456364091022753 23.85596399099775 40-41 23.718429607401852 26.03150787696924 26.79419854963741 23.455863965991497 42-43 22.73068267066767 27.68192048012003 26.131532883220803 23.455863965991497 44-45 23.36834208552138 25.381345336334082 27.019254813703427 24.23105776444111 46-47 23.88097024256064 26.30657664416104 25.79394848712178 24.01850462615654 48-49 22.85571392848212 26.231557889472366 27.70692673168292 23.20580145036259 50-51 23.768442110527634 26.081520380095025 26.16904226056514 23.980995248812203 52-53 22.9057264316079 25.868967241810452 25.831457864466117 25.393848462115532 54-55 24.518629657414355 26.006501625406354 25.881470367591895 23.593398349587396 56-57 23.080770192548137 26.944236059014752 25.531382845711427 24.44361090272568 58-59 23.093273318329583 25.943985996499126 26.469117279319832 24.493623405851466 60-61 23.43085771442861 26.019004751187797 27.231807951987996 23.3183295823956 62-63 23.893473368342086 25.568892223055762 26.731682920730183 23.80595148787197 64-65 23.95598899724931 26.319079769942487 26.51912978244561 23.20580145036259 66-67 23.74343585896474 26.93173293323331 26.30657664416104 23.018254563640912 68-69 24.406101525381345 27.144286071517882 25.456364091022753 22.99324831207802 70-71 23.88097024256064 25.818954738684667 26.131532883220803 24.168542135533883 72-73 24.23105776444111 25.71892973243311 26.60665166291573 23.443360840210055 74-75 24.987493746873437 25.52526263131566 26.463231615807903 23.024012006003 76-77 24.080560420315237 27.107830873154864 25.469101826369776 23.34250688016012 78-79 24.09608407356437 26.222945076942324 26.18541223570624 23.49555861378706 80-81 24.674674674674673 26.776776776776778 24.987487487487485 23.56106106106106 82-83 23.5985985985986 26.238738738738736 26.601601601601605 23.56106106106106 84-85 23.165539694465316 26.521412471825695 25.88279489105935 24.430252942649634 86-87 24.27998998246932 26.972201352366643 25.97044828449787 22.777360380666163 88-89 24.75582268970699 26.02053593789131 26.68419734535437 22.539444027047335 90-91 24.33007763586276 26.34610568494866 25.64487853744052 23.67893814174806 92-93 24.142248935637365 26.809416478837967 26.22088655146506 22.827448034059607 94-95 23.659819639278556 25.651302605210418 26.690881763527052 23.997995991983966 96-97 24.262953205369463 26.307866014301844 26.734412244385897 22.694768535942792 98-99 23.670450197678868 25.44318326744038 26.23389873740594 24.652467797474813 100-101 25.434439178515007 10.75829383886256 33.61769352290679 30.18957345971564 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 25.0 1 16.5 2 7.0 3 4.5 4 2.0 5 1.5 6 2.0 7 1.5 8 1.0 9 1.0 10 0.5 11 1.5 12 2.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 2.5 25 2.5 26 4.0 27 4.5 28 4.5 29 9.0 30 11.5 31 18.0 32 21.5 33 19.0 34 34.0 35 51.0 36 63.5 37 84.0 38 108.0 39 116.0 40 121.5 41 134.5 42 173.0 43 199.0 44 194.0 45 203.5 46 212.5 47 209.5 48 185.5 49 171.0 50 161.5 51 139.0 52 132.0 53 132.0 54 119.5 55 102.0 56 89.5 57 77.5 58 64.5 59 61.5 60 60.5 61 56.0 62 49.0 63 38.0 64 35.0 65 48.5 66 47.5 67 30.0 68 30.5 69 28.5 70 16.0 71 12.5 72 15.5 73 13.5 74 11.0 75 8.5 76 4.5 77 2.5 78 0.5 79 0.5 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.7999999999999998 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 1.0 74-75 1.0 76-77 0.0 78-79 1.0 80-81 0.0 82-83 3.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 2.0 96-97 31.0 98-99 356.0 100-101 3604.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.025 #Duplication Level Percentage of deduplicated Percentage of total 1 91.28019994445987 82.175 2 7.997778394890307 14.399999999999999 3 0.5276312135517912 1.425 4 0.0833101916134407 0.3 5 0.0 0.0 6 0.027770063871146906 0.15 7 0.027770063871146906 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05554012774229381 1.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 25 0.625 TruSeq Adapter, Index 2 (97% over 37bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409535 spots for SRR21853493.sra Written 1409535 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra Read 1409533 spots for SRR21853493.sra Written 1409533 spots for SRR21853493.sra SRR ids: ['SRR21853493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dyp8wk2m SRR21853493.sra spots: 28190662 blocks: [[1, 1409533], [1409534, 2819066], [2819067, 4228599], [4228600, 5638132], [5638133, 7047665], [7047666, 8457198], [8457199, 9866731], [9866732, 11276264], [11276265, 12685797], [12685798, 14095330], [14095331, 15504863], [15504864, 16914396], [16914397, 18323929], [18323930, 19733462], [19733463, 21142995], [21142996, 22552528], [22552529, 23962061], [23962062, 25371594], [25371595, 26781127], [26781128, 28190662]] SRR21853493 file size 7597957 SRR21853493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853493 SRR21853493_1.fastq Input file: SRR21853493_1.fastq trimmed: SRR21853493-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:13:58 2024 >> started Fri Dec 6 16:14:12 2024 >> done (13.637s) 28190662 reads processed; of these: 15 ( 0.00%) short reads filtered out after trimming by size control 284358 ( 1.01%) empty reads filtered out after trimming by size control 27906289 (98.99%) reads available; of these: 416 ( 0.00%) trimmed reads available after processing 27905873 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 3 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 4 0.00% 27 8 0.00% 28 4 0.00% 29 4 0.00% 30 10 0.00% 31 2 0.00% 32 6 0.00% 33 7 0.00% 34 3 0.00% 35 51 0.00% 36 64 0.00% 37 56 0.00% 38 75 0.00% 39 79 0.00% 40 85 0.00% 41 88 0.00% 42 72 0.00% 43 80 0.00% 44 74 0.00% 45 78 0.00% 46 100 0.00% 47 109 0.00% 48 121 0.00% 49 162 0.00% 50 136 0.00% 51 148 0.00% 52 144 0.00% 53 177 0.00% 54 144 0.00% 55 118 0.00% 56 196 0.00% 57 200 0.00% 58 208 0.00% 59 251 0.00% 60 263 0.00% 61 296 0.00% 62 273 0.00% 63 346 0.00% 64 307 0.00% 65 340 0.00% 66 361 0.00% 67 343 0.00% 68 450 0.00% 69 387 0.00% 70 490 0.00% 71 518 0.00% 72 576 0.00% 73 599 0.00% 74 601 0.00% 75 629 0.00% 76 679 0.00% 77 759 0.00% 78 759 0.00% 79 930 0.00% 80 965 0.00% 81 931 0.00% 82 1263 0.00% 83 1327 0.00% 84 1495 0.01% 85 1478 0.01% 86 1729 0.01% 87 1804 0.01% 88 1914 0.01% 89 2068 0.01% 90 2421 0.01% 91 3927 0.01% 92 2812 0.01% 93 3179 0.01% 94 4161 0.01% 95 8698 0.03% 96 40331 0.14% 97 143965 0.52% 98 545063 1.95% 99 1901566 6.81% 100 6769589 24.26% 101 18452613 66.12% 27906289 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=19 prefix-density=0.16 prefix-fanout=2.3 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=10.28 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=1.8 sequence=CTCCAAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGGAAGCCGGGTTACGGTGCCCAACTGCGCGCTAACCTAGAACCCACAAAGGGTGTTGGTCGATTAAGACAGCAGGACGGTGGTCATGGAAGTCGAAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCCGAAAATGGATGGCGCTAAAGCGCGCGACCCACACCCGGCCATCTGGGCGAGCGCCATGCCCCGATGAGTAGGAGGGCGCGGCGGCCGCTGCAAAACCCGGGGCGCGAGCCCGGGCGGAGCGGCCGTCGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGGCCGAAGAGGAGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTAAGCCGATCCTAAGGGACGGGGTAACCCCGGCAGATAGCGCGATCACGCGTATCCCCCGAAAGGGAATCGGGTTAAGATTTCCCGAGCCGGGATG Started job on | Dec 06 16:14:29 Started mapping on | Dec 06 16:14:29 Finished on | Dec 06 16:15:11 Mapping speed, Million of reads per hour | 2391.97 Number of input reads | 27906289 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 24761562 Uniquely mapped reads % | 88.73% Average mapped length | 100.16 Number of splices: Total | 9153077 Number of splices: Annotated (sjdb) | 8671304 Number of splices: GT/AG | 9019313 Number of splices: GC/AG | 117912 Number of splices: AT/AC | 5408 Number of splices: Non-canonical | 10444 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1246444 % of reads mapped to multiple loci | 4.47% Number of reads mapped to too many loci | 1169695 % of reads mapped to too many loci | 4.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1898283 1898283 1898283 N_multimapping 1246444 1246444 1246444 N_noFeature 1529480 12751389 13171044 N_ambiguous 423199 28535 28910 UnstrandedReadsAssigned:22808883 PositiveStrandReadsAssigned:11981638 NegativeStrandReadsAssigned:11561608 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853493 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853493-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,906,289 reads, 24,149,566 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,224 rounds 52973 SRR21853493.ke.tsv 35125 SRR21853493.se.tsv 88098 total ==> SRR21853493.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 99.8131 8.86814 PNS24247 1044 945 30.5844 2.40679 PNS24249 1928 1829 102.436 4.16496 PNS24246 1044 945 30.5844 2.40679 PNS24248 1044 945 30.5844 2.40679 PNS24244 1471 1372 63.9972 3.46878 PNS24243 293 194 68 26.0662 KQK14069 1603 1504 10050.2 496.931 KQK14071 474 375 2784.6 552.207 ==> SRR21853493.se.tsv <== BRADI_1g14170v3 14736 BRADI_1g53295v3 190 BRADI_1g59795v3 1315 BRADI_1g07683v3 0 BRADI_1g00485v3 181 BRADI_1g20270v3 2822 BRADI_1g74790v3 75 BRADI_1g09890v3 4 BRADI_1g77505v3 488 BRADI_1g48960v3 0 SRR21853493 completed mapping pipeline successfully