Starting /dee2/code/volunteer_pipeline.sh SRR21853494 current disk space = 1550452305920 free memory = 1599203484 SRR21853494 SRAfilesize 54502e8d277ff61a4b0e2b5c572e2355 SRR21853494.sra SRR21853494.sra file validated SRR21853494 is single end SRR21853494 is conventional basespace SRR21853494 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.15025 37.0 37.0 37.0 25.0 37.0 2 34.653 37.0 37.0 37.0 25.0 37.0 3 35.59925 37.0 37.0 37.0 37.0 37.0 4 35.70975 37.0 37.0 37.0 37.0 37.0 5 35.89975 37.0 37.0 37.0 37.0 37.0 6 35.82875 37.0 37.0 37.0 37.0 37.0 7 35.60675 37.0 37.0 37.0 37.0 37.0 8 35.78325 37.0 37.0 37.0 37.0 37.0 9 35.86825 37.0 37.0 37.0 37.0 37.0 10-11 35.9215 37.0 37.0 37.0 37.0 37.0 12-13 35.8975 37.0 37.0 37.0 37.0 37.0 14-15 35.826499999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.91374999999999 37.0 37.0 37.0 37.0 37.0 18-19 35.885999999999996 37.0 37.0 37.0 37.0 37.0 20-21 35.81275 37.0 37.0 37.0 37.0 37.0 22-23 35.857749999999996 37.0 37.0 37.0 37.0 37.0 24-25 35.7685 37.0 37.0 37.0 37.0 37.0 26-27 35.684 37.0 37.0 37.0 37.0 37.0 28-29 35.66975 37.0 37.0 37.0 37.0 37.0 30-31 35.65575 37.0 37.0 37.0 37.0 37.0 32-33 35.625249999999994 37.0 37.0 37.0 37.0 37.0 34-35 35.60125 37.0 37.0 37.0 37.0 37.0 36-37 35.65241310327582 37.0 37.0 37.0 37.0 37.0 38-39 35.559889972493124 37.0 37.0 37.0 37.0 37.0 40-41 35.56164041010253 37.0 37.0 37.0 37.0 37.0 42-43 35.48712178044511 37.0 37.0 37.0 37.0 37.0 44-45 35.45286321580395 37.0 37.0 37.0 37.0 37.0 46-47 35.44211052763191 37.0 37.0 37.0 37.0 37.0 48-49 35.49637409352338 37.0 37.0 37.0 37.0 37.0 50-51 35.629157289322336 37.0 37.0 37.0 37.0 37.0 52-53 35.47986996749187 37.0 37.0 37.0 37.0 37.0 54-55 35.45661415353838 37.0 37.0 37.0 37.0 37.0 56-57 35.46486621655414 37.0 37.0 37.0 37.0 37.0 58-59 35.52788197049262 37.0 37.0 37.0 37.0 37.0 60-61 35.47611902975744 37.0 37.0 37.0 37.0 37.0 62-63 35.46036509127282 37.0 37.0 37.0 37.0 37.0 64-65 35.33883470867717 37.0 37.0 37.0 31.0 37.0 66-67 35.429857464366094 37.0 37.0 37.0 37.0 37.0 68-69 35.274818704676164 37.0 37.0 37.0 31.0 37.0 70-71 35.2673168292073 37.0 37.0 37.0 37.0 37.0 72-73 35.34908727181795 37.0 37.0 37.0 31.0 37.0 74-75 35.39784946236559 37.0 37.0 37.0 37.0 37.0 76-77 35.2880720180045 37.0 37.0 37.0 31.0 37.0 78-79 35.404851212803194 37.0 37.0 37.0 37.0 37.0 80-81 35.32858214553639 37.0 37.0 37.0 37.0 37.0 82-83 35.24856214053513 37.0 37.0 37.0 37.0 37.0 84-85 35.2223055763941 37.0 37.0 37.0 31.0 37.0 86-87 35.25581395348837 37.0 37.0 37.0 31.0 37.0 88-89 35.348337084271066 37.0 37.0 37.0 37.0 37.0 90-91 35.283070767691925 37.0 37.0 37.0 31.0 37.0 92-93 35.32583145786447 37.0 37.0 37.0 37.0 37.0 94-95 35.3323883747325 37.0 37.0 37.0 31.0 37.0 96-97 35.20994711176319 37.0 37.0 37.0 25.0 37.0 98-99 35.3071155427666 37.0 37.0 37.0 31.0 37.0 100-101 35.08428863038293 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 8.0 25 11.0 26 11.0 27 22.0 28 37.0 29 64.0 30 85.0 31 115.0 32 105.0 33 174.0 34 289.0 35 511.0 36 2039.0 37 523.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.58289572393098 12.978244561140285 16.779194798699677 38.65966491622906 2 25.83841463414634 18.877032520325205 32.64735772357724 22.63719512195122 3 24.381095273818453 24.681170292573142 23.55588897224306 27.38184546136534 4 28.707176794198553 27.806951737934483 18.554638659664917 24.93123280820205 5 29.03225806451613 30.207551887971995 19.579894973743436 21.180295073768445 6 22.18054513628407 32.883220805201304 20.180045011252815 24.756189047261813 7 20.255063765941486 15.803950987746937 38.009502375593904 25.93148287071768 8 23.1807951987997 20.305076269067268 24.656164041010253 31.857964491122782 9 22.95573893473368 19.904976244061015 27.481870467616904 29.657414353588397 10-11 27.19429857464366 27.394348587146787 19.067266816704176 26.344086021505376 12-13 23.88097024256064 21.880470117529384 25.818954738684667 28.419604901225306 14-15 24.85621405351338 23.74343585896474 24.293573393348336 27.106776694173547 16-17 24.831207801950487 23.43085771442861 24.056014003500874 27.68192048012003 18-19 24.943735933983497 23.868467116779193 23.830957739434858 27.35683920980245 20-21 24.81870467616904 24.756189047261813 23.88097024256064 26.544136034008503 22-23 25.63140785196299 23.168292073018254 24.36859214803701 26.831707926981746 24-25 24.681170292573142 24.23105776444111 24.293573393348336 26.79419854963741 26-27 26.469117279319832 24.06851712928232 22.230557639409852 27.231807951987996 28-29 26.006501625406354 23.905976494123532 23.680920230057513 26.406601650412604 30-31 25.23130782695674 23.268317079269817 25.168792198049513 26.331582895723933 32-33 25.006251562890725 24.518629657414355 24.143535883970994 26.331582895723933 34-35 25.55638909727432 23.95598899724931 24.44361090272568 26.04401100275069 36-37 25.006251562890725 23.493373343335833 23.80595148787197 27.694423605901473 38-39 25.818954738684667 23.605901475368842 24.218554638659665 26.356589147286826 40-41 25.918979744936234 24.218554638659665 23.705926481620406 26.156539134783696 42-43 25.243810952738183 23.905976494123532 24.20605151287822 26.644161040260066 44-45 25.70642660665166 24.568642160540136 22.83070767691923 26.894223555888974 46-47 25.64391097774444 23.50587646911728 23.330832708177045 27.51937984496124 48-49 25.743935983995996 23.36834208552138 23.730932733183295 27.156789197299325 50-51 26.556639159789945 23.493373343335833 23.030757689422355 26.91922980745186 52-53 26.25656414103526 23.78094523630908 23.243310827706924 26.71917979494874 54-55 26.456614153538382 22.66816704176044 24.293573393348336 26.581645411352838 56-57 25.6064016004001 24.093523380845213 23.168292073018254 27.131782945736433 58-59 25.893973493373345 23.330832708177045 24.168542135533883 26.60665166291573 60-61 25.806451612903224 22.893223305826456 23.443360840210055 27.85696424106027 62-63 25.918979744936234 23.618404601150285 23.718429607401852 26.744186046511626 64-65 25.243810952738183 24.55613903475869 23.680920230057513 26.51912978244561 66-67 25.64391097774444 24.256064016004 23.393348337084273 26.70667666916729 68-69 25.55638909727432 24.33108277069267 22.680670167541887 27.431857964491122 70-71 26.619154788697173 23.48087021755439 22.95573893473368 26.944236059014752 72-73 26.03150787696924 24.081020255063766 22.99324831207802 26.894223555888974 74-75 26.456614153538382 24.268567141785446 23.10577644411103 26.16904226056514 76-77 26.6816704176044 23.843460865216304 23.50587646911728 25.968992248062015 78-79 26.244061015253813 23.193298324581146 23.518379594898725 27.04426106526632 80-81 26.619154788697173 23.893473368342086 22.980745186296573 26.506626656664167 82-83 27.031757939484873 23.330832708177045 23.018254563640912 26.619154788697173 84-85 26.244061015253813 23.605901475368842 23.443360840210055 26.70667666916729 86-87 26.981745436359088 23.43085771442861 23.093273318329583 26.494123530882717 88-89 26.30657664416104 23.93098274568642 23.455863965991497 26.30657664416104 90-91 27.781945486371594 23.818454613653415 22.093023255813954 26.30657664416104 92-93 26.44411102775694 23.980995248812203 23.680920230057513 25.893973493373345 94-95 26.53495060647743 23.471301738151805 22.483431286732525 27.51031636863824 96-97 26.45145145145145 24.036536536536538 23.085585585585587 26.426426426426424 98-99 26.221601726107373 22.299784236578247 23.746668358928797 27.731945678385582 100-101 27.56798756798757 10.458430458430458 28.91996891996892 33.05361305361305 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 1.0 25 2.0 26 2.0 27 2.0 28 4.0 29 6.5 30 5.5 31 9.0 32 12.0 33 10.5 34 23.0 35 27.0 36 26.0 37 46.5 38 57.5 39 68.0 40 85.5 41 103.0 42 122.5 43 145.0 44 158.5 45 150.5 46 151.5 47 163.5 48 167.5 49 155.0 50 148.0 51 150.5 52 133.0 53 106.0 54 94.5 55 102.5 56 104.0 57 91.5 58 83.5 59 95.5 60 92.5 61 80.0 62 95.0 63 96.0 64 86.0 65 88.0 66 82.0 67 71.5 68 71.5 69 68.5 70 63.0 71 51.0 72 46.5 73 42.0 74 33.0 75 35.5 76 31.5 77 22.5 78 12.0 79 3.0 80 2.5 81 3.5 82 2.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.6 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 21.0 98-99 327.0 100-101 3650.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10166712216451 84.25 2 6.914457502049741 12.65 3 0.8198961464881116 2.25 4 0.10931948619841486 0.4 5 0.0 0.0 6 0.027329871549603715 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027329871549603715 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 12 0.3 TruSeq Adapter, Index 2 (97% over 37bp) CAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACTAGGCATTCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0125 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967862 spots for SRR21853494.sra Written 967862 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra Read 967860 spots for SRR21853494.sra Written 967860 spots for SRR21853494.sra SRR ids: ['SRR21853494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_st5tl_kl SRR21853494.sra spots: 19357202 blocks: [[1, 967860], [967861, 1935720], [1935721, 2903580], [2903581, 3871440], [3871441, 4839300], [4839301, 5807160], [5807161, 6775020], [6775021, 7742880], [7742881, 8710740], [8710741, 9678600], [9678601, 10646460], [10646461, 11614320], [11614321, 12582180], [12582181, 13550040], [13550041, 14517900], [14517901, 15485760], [15485761, 16453620], [16453621, 17421480], [17421481, 18389340], [18389341, 19357202]] SRR21853494 file size 5214755 SRR21853494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853494 SRR21853494_1.fastq Input file: SRR21853494_1.fastq trimmed: SRR21853494-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:13:59 2024 >> started Fri Dec 6 16:14:10 2024 >> done (11.088s) 19357202 reads processed; of these: 33 ( 0.00%) short reads filtered out after trimming by size control 66854 ( 0.35%) empty reads filtered out after trimming by size control 19290315 (99.65%) reads available; of these: 501 ( 0.00%) trimmed reads available after processing 19289814 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 3 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 8 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 2 0.00% 30 9 0.00% 31 6 0.00% 32 2 0.00% 33 8 0.00% 34 8 0.00% 35 103 0.00% 36 119 0.00% 37 153 0.00% 38 107 0.00% 39 133 0.00% 40 154 0.00% 41 175 0.00% 42 150 0.00% 43 142 0.00% 44 127 0.00% 45 168 0.00% 46 158 0.00% 47 160 0.00% 48 145 0.00% 49 163 0.00% 50 171 0.00% 51 149 0.00% 52 167 0.00% 53 180 0.00% 54 194 0.00% 55 200 0.00% 56 180 0.00% 57 192 0.00% 58 208 0.00% 59 231 0.00% 60 197 0.00% 61 201 0.00% 62 180 0.00% 63 214 0.00% 64 241 0.00% 65 217 0.00% 66 265 0.00% 67 209 0.00% 68 225 0.00% 69 258 0.00% 70 242 0.00% 71 244 0.00% 72 233 0.00% 73 259 0.00% 74 255 0.00% 75 262 0.00% 76 309 0.00% 77 299 0.00% 78 300 0.00% 79 366 0.00% 80 335 0.00% 81 347 0.00% 82 411 0.00% 83 360 0.00% 84 437 0.00% 85 385 0.00% 86 483 0.00% 87 439 0.00% 88 482 0.00% 89 544 0.00% 90 601 0.00% 91 1132 0.01% 92 621 0.00% 93 808 0.00% 94 1541 0.01% 95 5219 0.03% 96 26928 0.14% 97 86866 0.45% 98 337825 1.75% 99 1290952 6.69% 100 4267490 22.12% 101 13257034 68.72% 19290315 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=12.61 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=2.7 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC Started job on | Dec 06 16:14:32 Started mapping on | Dec 06 16:14:33 Finished on | Dec 06 16:14:55 Mapping speed, Million of reads per hour | 3156.60 Number of input reads | 19290315 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17769564 Uniquely mapped reads % | 92.12% Average mapped length | 100.24 Number of splices: Total | 6056307 Number of splices: Annotated (sjdb) | 5764509 Number of splices: GT/AG | 5972309 Number of splices: GC/AG | 72555 Number of splices: AT/AC | 3089 Number of splices: Non-canonical | 8354 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.84 Insertion rate per base | 0.00% Insertion average length | 1.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 667460 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 592586 % of reads mapped to too many loci | 3.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.91% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 853291 853291 853291 N_multimapping 667460 667460 667460 N_noFeature 620266 9055077 9090564 N_ambiguous 275996 18142 15617 UnstrandedReadsAssigned:16873302 PositiveStrandReadsAssigned:8696345 NegativeStrandReadsAssigned:8663383 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853494 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853494-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,290,315 reads, 17,469,673 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,208 rounds 52973 SRR21853494.ke.tsv 35125 SRR21853494.se.tsv 88098 total ==> SRR21853494.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 8.78734 0.975748 PNS24247 1044 945 24.5596 2.41544 PNS24249 1928 1829 168.42 8.55825 PNS24246 1044 945 24.5596 2.41544 PNS24248 1044 945 24.5596 2.41544 PNS24244 1471 1372 21.114 1.43028 PNS24243 293 194 18 8.62336 KQK14069 1603 1504 2168.83 134.024 KQK14071 474 375 291.999 72.3694 ==> SRR21853494.se.tsv <== BRADI_1g14170v3 2705 BRADI_1g53295v3 73 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 63 BRADI_1g20270v3 2220 BRADI_1g74790v3 90 BRADI_1g09890v3 5 BRADI_1g77505v3 226 BRADI_1g48960v3 0 SRR21853494 completed mapping pipeline successfully