Starting /dee2/code/volunteer_pipeline.sh SRR21853495 current disk space = 1550469681152 free memory = 1598978500 SRR21853495 SRAfilesize 4f624865d8ba2e45ee95aee10c6451c7 SRR21853495.sra SRR21853495.sra file validated SRR21853495 is single end SRR21853495 is conventional basespace SRR21853495 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.26425 37.0 37.0 37.0 37.0 37.0 2 34.936 37.0 37.0 37.0 25.0 37.0 3 35.83575 37.0 37.0 37.0 37.0 37.0 4 35.73575 37.0 37.0 37.0 37.0 37.0 5 35.96175 37.0 37.0 37.0 37.0 37.0 6 35.89725 37.0 37.0 37.0 37.0 37.0 7 35.64025 37.0 37.0 37.0 37.0 37.0 8 36.11025 37.0 37.0 37.0 37.0 37.0 9 35.85025 37.0 37.0 37.0 37.0 37.0 10-11 36.024 37.0 37.0 37.0 37.0 37.0 12-13 35.96475 37.0 37.0 37.0 37.0 37.0 14-15 35.93175 37.0 37.0 37.0 37.0 37.0 16-17 35.91275 37.0 37.0 37.0 37.0 37.0 18-19 35.9585 37.0 37.0 37.0 37.0 37.0 20-21 36.051500000000004 37.0 37.0 37.0 37.0 37.0 22-23 35.919 37.0 37.0 37.0 37.0 37.0 24-25 35.78575 37.0 37.0 37.0 37.0 37.0 26-27 35.78975 37.0 37.0 37.0 37.0 37.0 28-29 35.792249999999996 37.0 37.0 37.0 37.0 37.0 30-31 35.76875 37.0 37.0 37.0 37.0 37.0 32-33 35.73025 37.0 37.0 37.0 37.0 37.0 34-35 35.707 37.0 37.0 37.0 37.0 37.0 36-37 35.757939484871216 37.0 37.0 37.0 37.0 37.0 38-39 35.74362181090545 37.0 37.0 37.0 37.0 37.0 40-41 35.63281640820411 37.0 37.0 37.0 37.0 37.0 42-43 35.716944536816825 37.0 37.0 37.0 37.0 37.0 44-45 35.56892669502126 37.0 37.0 37.0 37.0 37.0 46-47 35.59069301976483 37.0 37.0 37.0 37.0 37.0 48-49 35.6642481861396 37.0 37.0 37.0 37.0 37.0 50-51 35.70077558168626 37.0 37.0 37.0 37.0 37.0 52-53 35.75065614776648 37.0 37.0 37.0 37.0 37.0 54-55 35.62887887887888 37.0 37.0 37.0 37.0 37.0 56-57 35.652152152152155 37.0 37.0 37.0 37.0 37.0 58-59 35.66641641641641 37.0 37.0 37.0 37.0 37.0 60-61 35.67117117117117 37.0 37.0 37.0 37.0 37.0 62-63 35.52802802802803 37.0 37.0 37.0 37.0 37.0 64-65 35.62512512512512 37.0 37.0 37.0 37.0 37.0 66-67 35.522272272272275 37.0 37.0 37.0 37.0 37.0 68-69 35.499249249249246 37.0 37.0 37.0 37.0 37.0 70-71 35.4552052052052 37.0 37.0 37.0 37.0 37.0 72-73 35.5538038038038 37.0 37.0 37.0 37.0 37.0 74-75 35.53678678678679 37.0 37.0 37.0 37.0 37.0 76-77 35.471471471471475 37.0 37.0 37.0 37.0 37.0 78-79 35.4964964964965 37.0 37.0 37.0 37.0 37.0 80-81 35.59734734734735 37.0 37.0 37.0 37.0 37.0 82-83 35.419169169169166 37.0 37.0 37.0 37.0 37.0 84-85 35.45150237847359 37.0 37.0 37.0 37.0 37.0 86-87 35.45412010381028 37.0 37.0 37.0 37.0 37.0 88-89 35.41292134796234 37.0 37.0 37.0 37.0 37.0 90-91 35.46280991735537 37.0 37.0 37.0 37.0 37.0 92-93 35.4000501002004 37.0 37.0 37.0 37.0 37.0 94-95 35.43987975951904 37.0 37.0 37.0 37.0 37.0 96-97 35.44087899833787 37.0 37.0 37.0 37.0 37.0 98-99 35.40535476891377 37.0 37.0 37.0 37.0 37.0 100-101 35.515399373116715 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 3.0 24 6.0 25 8.0 26 10.0 27 24.0 28 35.0 29 42.0 30 58.0 31 95.0 32 129.0 33 169.0 34 224.0 35 472.0 36 2170.0 37 550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.83270817704426 13.12828207051763 16.879219804951237 39.15978994748687 2 27.164556962025316 18.860759493670887 30.075949367088604 23.89873417721519 3 25.381345336334082 22.605651412853213 23.705926481620406 28.307076769192296 4 29.107276819204802 28.782195548887223 18.254563640910227 23.85596399099775 5 29.40735183795949 30.932733183295824 19.154788697174293 20.505126281570394 6 24.131032758189548 31.282820705176295 20.030007501875467 24.55613903475869 7 21.155288822205552 16.129032258064516 36.85921480370092 25.85646411602901 8 23.330832708177045 20.905226306576644 23.95598899724931 31.807951987997 9 23.055763940985248 20.80520130032508 27.781945486371594 28.35708927231808 10-11 26.881720430107524 26.981745436359088 19.579894973743436 26.556639159789945 12-13 25.381345336334082 21.817954488622153 24.90622655663916 27.894473618404604 14-15 24.793698424606152 23.905976494123532 23.593398349587396 27.70692673168292 16-17 25.93148287071768 24.36859214803701 22.58064516129032 27.11927981995499 18-19 24.943735933983497 23.53088272068017 24.3935983995999 27.131782945736433 20-21 25.743935983995996 23.218304576144035 23.36834208552138 27.66941735433858 22-23 25.44386096524131 24.69367341835459 23.680920230057513 26.18154538634659 24-25 26.281570392598148 23.43085771442861 22.930732683170792 27.35683920980245 26-27 25.76894223555889 24.093523380845213 22.55563890972743 27.581895473868467 28-29 25.93148287071768 24.043510877719427 23.36834208552138 26.65666416604151 30-31 24.06851712928232 24.618654663665918 23.843460865216304 27.46936734183546 32-33 26.11902975743936 23.393348337084273 23.018254563640912 27.46936734183546 34-35 25.71892973243311 23.330832708177045 23.43085771442861 27.51937984496124 36-37 25.206301575393848 23.718429607401852 23.305826456614152 27.769442360590148 38-39 26.450725362681343 23.74937468734367 23.024012006003 26.775887943971988 40-41 25.30015007503752 23.911955977988995 23.92446223111556 26.863431715857928 42-43 25.115697310819264 24.04002501563477 24.015009380863038 26.82926829268293 44-45 24.981235926945207 24.10557918438829 23.8804103077308 27.032774580935705 46-47 26.36977733299975 23.53014761070803 23.492619464598448 26.607455591693768 48-49 25.544158118588946 24.618463847885916 23.254941205904426 26.582436827620715 50-51 27.420565424068048 23.079809857393045 23.079809857393045 26.419814861145856 52-53 26.435631177280122 23.25785061929188 23.48304766670837 26.82347053671963 54-55 26.651651651651655 23.773773773773772 22.3973973973974 27.177177177177175 56-57 26.413913913913913 23.323323323323322 23.623623623623622 26.63913913913914 58-59 26.514014014014016 22.57257257257257 22.62262262262262 28.290790790790794 60-61 26.163663663663662 23.886386386386384 23.71121121121121 26.238738738738736 62-63 25.95095095095095 23.623623623623622 23.873873873873876 26.55155155155155 64-65 26.2012012012012 23.235735735735734 23.473473473473476 27.08958958958959 66-67 25.513013013013015 24.34934934934935 23.773773773773772 26.363863863863862 68-69 26.626626626626624 23.523523523523522 22.885385385385383 26.964464464464466 70-71 26.826826826826828 24.124124124124123 21.97197197197197 27.077077077077078 72-73 26.539039039039036 24.136636636636634 22.935435435435437 26.38888888888889 74-75 27.364864864864863 23.523523523523522 22.772772772772772 26.33883883883884 76-77 27.239739739739736 24.16166166166166 22.45995995995996 26.13863863863864 78-79 26.876876876876878 23.56106106106106 23.423423423423422 26.13863863863864 80-81 26.514014014014016 23.135635635635634 23.24824824824825 27.102102102102105 82-83 26.288788788788786 24.024024024024023 23.335835835835837 26.351351351351347 84-85 25.81654361156301 24.02703040921036 22.7255662620448 27.43085971718183 86-87 27.062210539491797 23.70759794717737 23.13180623357116 26.09838527975967 88-89 26.442969825967193 22.699386503067483 24.026543132590458 26.83110053837486 90-91 26.82193839218633 24.818432256448787 22.176308539944902 26.183320811419986 92-93 26.302605210420843 23.73496993987976 24.36122244488978 25.60120240480962 94-95 26.853707414829657 22.49498997995992 23.233967935871743 27.41733466933868 96-97 26.385058912008024 23.589872148408123 23.050889947355227 26.97417899222863 98-99 27.015361178113494 22.546654817824045 23.384537260378316 27.053446743684145 100-101 27.898326100433973 10.88034717916925 28.316800991940482 32.90452572845629 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 2.5 26 1.5 27 1.0 28 2.0 29 1.5 30 1.5 31 6.0 32 7.5 33 10.5 34 18.5 35 27.5 36 37.5 37 45.0 38 55.5 39 68.5 40 74.5 41 95.5 42 122.0 43 123.5 44 135.5 45 161.0 46 162.0 47 157.0 48 151.0 49 134.0 50 136.5 51 139.5 52 123.5 53 122.5 54 121.0 55 111.5 56 126.0 57 123.5 58 108.0 59 112.0 60 113.5 61 99.5 62 80.0 63 90.5 64 93.5 65 77.0 66 79.5 67 74.0 68 68.0 69 66.0 70 60.0 71 56.5 72 49.0 73 41.0 74 32.5 75 27.0 76 23.0 77 15.5 78 8.5 79 6.0 80 4.5 81 3.0 82 2.5 83 2.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.25 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 1.0 38-39 0.0 40-41 0.0 42-43 1.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 1.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 1.0 86-87 1.0 88-89 1.0 90-91 1.0 92-93 0.0 94-95 0.0 96-97 20.0 98-99 311.0 100-101 3661.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 90.86896551724138 82.35 2 8.248275862068965 14.95 3 0.8 2.175 4 0.05517241379310345 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027586206896551724 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 13 0.325 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra Read 1211907 spots for SRR21853495.sra Written 1211907 spots for SRR21853495.sra Read 1211891 spots for SRR21853495.sra Written 1211891 spots for SRR21853495.sra SRR ids: ['SRR21853495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2suw30fe SRR21853495.sra spots: 24237836 blocks: [[1, 1211891], [1211892, 2423782], [2423783, 3635673], [3635674, 4847564], [4847565, 6059455], [6059456, 7271346], [7271347, 8483237], [8483238, 9695128], [9695129, 10907019], [10907020, 12118910], [12118911, 13330801], [13330802, 14542692], [14542693, 15754583], [15754584, 16966474], [16966475, 18178365], [18178366, 19390256], [19390257, 20602147], [20602148, 21814038], [21814039, 23025929], [23025930, 24237836]] SRR21853495 file size 6531962 SRR21853495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853495 SRR21853495_1.fastq Input file: SRR21853495_1.fastq trimmed: SRR21853495-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:15:07 2024 >> started Fri Dec 6 16:15:18 2024 >> done (11.221s) 24237836 reads processed; of these: 40 ( 0.00%) short reads filtered out after trimming by size control 95235 ( 0.39%) empty reads filtered out after trimming by size control 24142561 (99.61%) reads available; of these: 492 ( 0.00%) trimmed reads available after processing 24142069 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 6 0.00% 26 3 0.00% 27 4 0.00% 28 2 0.00% 29 7 0.00% 30 6 0.00% 31 10 0.00% 32 6 0.00% 33 10 0.00% 34 8 0.00% 35 182 0.00% 36 196 0.00% 37 206 0.00% 38 195 0.00% 39 183 0.00% 40 197 0.00% 41 208 0.00% 42 192 0.00% 43 191 0.00% 44 196 0.00% 45 213 0.00% 46 224 0.00% 47 234 0.00% 48 207 0.00% 49 224 0.00% 50 237 0.00% 51 214 0.00% 52 221 0.00% 53 281 0.00% 54 225 0.00% 55 249 0.00% 56 250 0.00% 57 249 0.00% 58 295 0.00% 59 300 0.00% 60 337 0.00% 61 306 0.00% 62 320 0.00% 63 319 0.00% 64 351 0.00% 65 359 0.00% 66 353 0.00% 67 389 0.00% 68 375 0.00% 69 406 0.00% 70 389 0.00% 71 426 0.00% 72 469 0.00% 73 455 0.00% 74 487 0.00% 75 475 0.00% 76 542 0.00% 77 568 0.00% 78 585 0.00% 79 592 0.00% 80 688 0.00% 81 701 0.00% 82 668 0.00% 83 813 0.00% 84 813 0.00% 85 848 0.00% 86 923 0.00% 87 964 0.00% 88 1008 0.00% 89 1128 0.00% 90 1234 0.01% 91 2854 0.01% 92 1702 0.01% 93 1881 0.01% 94 2557 0.01% 95 6989 0.03% 96 32952 0.14% 97 105345 0.44% 98 408844 1.69% 99 1614196 6.69% 100 5275563 21.85% 101 16665734 69.03% 24142561 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.3 sequence=CCCACTTGGAGC criterion=fanout-score sequence-density=0.16 sequence-density-rank=14 fanout-score=10.57 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=3.3 sequence=TCCAGCTCCTTGAGCACCTG Started job on | Dec 06 16:15:38 Started mapping on | Dec 06 16:15:38 Finished on | Dec 06 16:16:11 Mapping speed, Million of reads per hour | 2633.73 Number of input reads | 24142561 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19658946 Uniquely mapped reads % | 81.43% Average mapped length | 100.19 Number of splices: Total | 6538651 Number of splices: Annotated (sjdb) | 6221328 Number of splices: GT/AG | 6444047 Number of splices: GC/AG | 77804 Number of splices: AT/AC | 3474 Number of splices: Non-canonical | 13326 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.00% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1709896 % of reads mapped to multiple loci | 7.08% Number of reads mapped to too many loci | 2192993 % of reads mapped to too many loci | 9.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.16% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2773719 2773719 2773719 N_multimapping 1709896 1709896 1709896 N_noFeature 765006 10036336 10106955 N_ambiguous 315519 18222 18798 UnstrandedReadsAssigned:18578421 PositiveStrandReadsAssigned:9604388 NegativeStrandReadsAssigned:9533193 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853495 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853495-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,142,561 reads, 19,617,123 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52973 SRR21853495.ke.tsv 35125 SRR21853495.se.tsv 88098 total ==> SRR21853495.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 36.9515 3.43849 PNS24247 1044 945 28.3548 2.33699 PNS24249 1928 1829 134.264 5.71752 PNS24246 1044 945 28.3548 2.33699 PNS24248 1044 945 28.3548 2.33699 PNS24244 1471 1372 62.7199 3.56052 PNS24243 293 194 7 2.81033 KQK14069 1603 1504 2399.75 124.274 KQK14071 474 375 519.727 107.946 ==> SRR21853495.se.tsv <== BRADI_1g14170v3 3175 BRADI_1g53295v3 55 BRADI_1g59795v3 372 BRADI_1g07683v3 0 BRADI_1g00485v3 58 BRADI_1g20270v3 2621 BRADI_1g74790v3 99 BRADI_1g09890v3 20 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR21853495 completed mapping pipeline successfully