Starting /dee2/code/volunteer_pipeline.sh SRR21853496 current disk space = 1550551076864 free memory = 1595316092 SRR21853496 SRAfilesize 7a572722f38c64ed7a3e55425ebf7850 SRR21853496.sra SRR21853496.sra file validated SRR21853496 is single end SRR21853496 is conventional basespace SRR21853496 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853496_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.13775 37.0 37.0 37.0 25.0 37.0 2 34.82 37.0 37.0 37.0 25.0 37.0 3 35.63075 37.0 37.0 37.0 37.0 37.0 4 35.75575 37.0 37.0 37.0 37.0 37.0 5 35.81325 37.0 37.0 37.0 37.0 37.0 6 35.85925 37.0 37.0 37.0 37.0 37.0 7 35.62125 37.0 37.0 37.0 37.0 37.0 8 35.72075 37.0 37.0 37.0 37.0 37.0 9 35.87275 37.0 37.0 37.0 37.0 37.0 10-11 35.838750000000005 37.0 37.0 37.0 37.0 37.0 12-13 35.887 37.0 37.0 37.0 37.0 37.0 14-15 35.825 37.0 37.0 37.0 37.0 37.0 16-17 35.82325 37.0 37.0 37.0 37.0 37.0 18-19 35.8825 37.0 37.0 37.0 37.0 37.0 20-21 35.86125 37.0 37.0 37.0 37.0 37.0 22-23 35.8085 37.0 37.0 37.0 37.0 37.0 24-25 35.82175 37.0 37.0 37.0 37.0 37.0 26-27 35.676 37.0 37.0 37.0 37.0 37.0 28-29 35.66775 37.0 37.0 37.0 37.0 37.0 30-31 35.710750000000004 37.0 37.0 37.0 37.0 37.0 32-33 35.64575000000001 37.0 37.0 37.0 37.0 37.0 34-35 35.557 37.0 37.0 37.0 37.0 37.0 36-37 35.541635408852216 37.0 37.0 37.0 37.0 37.0 38-39 35.74268567141786 37.0 37.0 37.0 37.0 37.0 40-41 35.50887721930482 37.0 37.0 37.0 37.0 37.0 42-43 35.50137534383596 37.0 37.0 37.0 37.0 37.0 44-45 35.69617404351088 37.0 37.0 37.0 37.0 37.0 46-47 35.515628907226805 37.0 37.0 37.0 37.0 37.0 48-49 35.50812703175794 37.0 37.0 37.0 37.0 37.0 50-51 35.51862965741435 37.0 37.0 37.0 37.0 37.0 52-53 35.42535633908477 37.0 37.0 37.0 37.0 37.0 54-55 35.53413353338334 37.0 37.0 37.0 37.0 37.0 56-57 35.554388597149284 37.0 37.0 37.0 37.0 37.0 58-59 35.52338084521131 37.0 37.0 37.0 37.0 37.0 60-61 35.46861715428857 37.0 37.0 37.0 37.0 37.0 62-63 35.47011752938234 37.0 37.0 37.0 37.0 37.0 64-65 35.33633408352088 37.0 37.0 37.0 37.0 37.0 66-67 35.39609902475619 37.0 37.0 37.0 37.0 37.0 68-69 35.227556889222306 37.0 37.0 37.0 31.0 37.0 70-71 35.335333833458364 37.0 37.0 37.0 37.0 37.0 72-73 35.34008502125531 37.0 37.0 37.0 37.0 37.0 74-75 35.32658164541135 37.0 37.0 37.0 31.0 37.0 76-77 35.23405851462866 37.0 37.0 37.0 31.0 37.0 78-79 35.33183295823956 37.0 37.0 37.0 37.0 37.0 80-81 35.47936984246061 37.0 37.0 37.0 37.0 37.0 82-83 35.34208552138034 37.0 37.0 37.0 37.0 37.0 84-85 35.229557389347335 37.0 37.0 37.0 25.0 37.0 86-87 35.30607651912979 37.0 37.0 37.0 31.0 37.0 88-89 35.14453613403351 37.0 37.0 37.0 25.0 37.0 90-91 35.26231557889473 37.0 37.0 37.0 31.0 37.0 92-93 35.20130032508127 37.0 37.0 37.0 31.0 37.0 94-95 35.10152538134534 37.0 37.0 37.0 25.0 37.0 96-97 35.22085203002504 37.0 37.0 37.0 31.0 37.0 98-99 35.234431548461274 37.0 37.0 37.0 37.0 37.0 100-101 35.11085271773068 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 4.0 25 9.0 26 23.0 27 26.0 28 51.0 29 51.0 30 84.0 31 98.0 32 142.0 33 170.0 34 253.0 35 520.0 36 2080.0 37 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.332333083270818 11.75293823455864 17.454363590897724 41.46036509127281 2 25.392802838317287 18.930562595032946 30.765331981753675 24.9113025848961 3 26.456614153538382 23.88097024256064 22.55563890972743 27.106776694173547 4 26.6816704176044 28.707176794198553 19.179794948737182 25.431357839459867 5 27.181795448862218 30.23255813953488 20.630157539384847 21.955488872218055 6 22.655663915978995 33.18329582395599 21.280320080020005 22.88072018004501 7 19.604901225306325 15.478869717429358 39.53488372093023 25.381345336334082 8 21.8304576144036 21.555388847211805 25.381345336334082 31.23280820205051 9 22.030507626906726 20.230057514378593 28.432108027006752 29.307326831707925 10-11 26.994248562140534 26.71917979494874 20.142535633908476 26.144036009002253 12-13 24.281070267566893 22.443110777694425 25.381345336334082 27.894473618404604 14-15 24.90622655663916 24.718679669917478 23.905976494123532 26.469117279319832 16-17 25.23130782695674 24.44361090272568 23.655913978494624 26.669167291822955 18-19 24.36859214803701 25.656414103525883 23.93098274568642 26.04401100275069 20-21 24.706176544136035 24.543635908977244 24.50612653163291 26.244061015253813 22-23 25.09377344336084 24.893723430857715 24.093523380845213 25.918979744936234 24-25 24.593648412103025 24.3935983995999 25.131282820705174 25.881470367591895 26-27 25.018754688672168 25.206301575393848 23.768442110527634 26.006501625406354 28-29 24.58114528632158 24.63115778944736 23.95598899724931 26.831707926981746 30-31 24.718679669917478 24.956239059764943 24.5311327831958 25.79394848712178 32-33 25.18129532383096 25.49387346836709 23.95598899724931 25.36884221055264 34-35 25.10627656914228 24.981245311327832 23.43085771442861 26.481620405101275 36-37 25.218804701175294 25.29382345586397 24.031007751937985 25.456364091022753 38-39 24.81870467616904 24.981245311327832 23.893473368342086 26.30657664416104 40-41 25.76894223555889 24.5311327831958 24.23105776444111 25.468867216804203 42-43 25.09377344336084 25.006251562890725 24.656164041010253 25.243810952738183 44-45 25.581395348837212 24.5311327831958 23.293323330832706 26.59414853713428 46-47 25.881470367591895 24.343585896474117 23.943485871467868 25.831457864466117 48-49 25.406351587896975 23.905976494123532 24.031007751937985 26.65666416604151 50-51 24.968742185546386 25.406351587896975 24.01850462615654 25.6064016004001 52-53 25.468867216804203 23.50587646911728 24.60615153788447 26.419104776194047 54-55 26.156539134783696 23.40585146286572 23.74343585896474 26.694173543385848 56-57 25.143785946486624 24.656164041010253 24.99374843710928 25.206301575393848 58-59 25.431357839459867 24.63115778944736 23.193298324581146 26.744186046511626 60-61 25.568892223055762 24.868717179294826 23.418354588647162 26.144036009002253 62-63 25.98149537384346 24.343585896474117 23.718429607401852 25.95648912228057 64-65 25.756439109777446 24.643660915228807 23.618404601150285 25.98149537384346 66-67 25.893973493373345 24.88122030507627 23.718429607401852 25.506376594148538 68-69 25.006251562890725 24.218554638659665 23.793448362090523 26.981745436359088 70-71 26.59414853713428 24.668667166791696 23.15578894723681 25.581395348837212 72-73 26.344086021505376 25.068767191797946 23.080770192548137 25.506376594148538 74-75 26.431607901975497 24.493623405851466 23.74343585896474 25.331332833208304 76-77 25.756439109777446 24.831207801950487 23.78094523630908 25.63140785196299 78-79 25.656414103525883 24.293573393348336 23.355838959739934 26.694173543385848 80-81 25.343835958989747 24.8062015503876 24.60615153788447 25.243810952738183 82-83 25.93148287071768 23.718429607401852 24.356089022255563 25.993998499624904 84-85 25.006251562890725 25.78144536134033 23.55588897224306 25.656414103525883 86-87 25.506376594148538 24.36859214803701 24.343585896474117 25.78144536134033 88-89 25.84396099024756 24.006001500375092 24.406101525381345 25.743935983995996 90-91 25.6064016004001 24.943735933983497 23.905976494123532 25.543885971492873 92-93 25.906476619154787 24.99374843710928 23.50587646911728 25.593898474618655 94-95 26.294073518379594 23.768442110527634 24.193548387096776 25.743935983995996 96-97 25.72608913370055 24.161241862794192 23.510265398097147 26.602403605408114 98-99 26.028611216609697 22.737055323458666 24.800607671857197 26.43372578807444 100-101 27.510849349039056 9.965902045877248 29.959702417854928 32.563546187228766 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 2.0 4 1.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 5.0 28 7.0 29 8.0 30 7.5 31 13.5 32 15.0 33 19.0 34 32.0 35 34.5 36 34.5 37 47.0 38 60.0 39 74.5 40 99.0 41 112.0 42 128.0 43 147.5 44 156.5 45 165.5 46 168.0 47 176.5 48 173.0 49 155.0 50 143.5 51 140.0 52 143.5 53 123.0 54 118.0 55 120.5 56 113.5 57 104.0 58 90.5 59 86.0 60 77.0 61 73.0 62 74.5 63 71.5 64 62.0 65 63.0 66 68.5 67 61.5 68 57.5 69 55.0 70 54.5 71 51.0 72 34.5 73 30.0 74 28.5 75 22.5 76 24.0 77 19.0 78 12.5 79 11.0 80 7.0 81 3.5 82 2.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.35 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 21.0 98-99 315.0 100-101 3662.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 91.32821075740945 83.2 2 7.848518111964873 14.299999999999999 3 0.6311745334796927 1.725 4 0.13721185510428102 0.5 5 0.027442371020856202 0.125 6 0.027442371020856202 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCGCGTAT 5 0.125 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.025 3 0.0 0.0 0.0 0.0 0.025 4 0.0 0.0 0.0 0.0 0.025 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080801 spots for SRR21853496.sra Written 1080801 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra Read 1080791 spots for SRR21853496.sra Written 1080791 spots for SRR21853496.sra SRR ids: ['SRR21853496.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vjza38oo SRR21853496.sra spots: 21615830 blocks: [[1, 1080791], [1080792, 2161582], [2161583, 3242373], [3242374, 4323164], [4323165, 5403955], [5403956, 6484746], [6484747, 7565537], [7565538, 8646328], [8646329, 9727119], [9727120, 10807910], [10807911, 11888701], [11888702, 12969492], [12969493, 14050283], [14050284, 15131074], [15131075, 16211865], [16211866, 17292656], [17292657, 18373447], [18373448, 19454238], [19454239, 20535029], [20535030, 21615830]] SRR21853496 file size 5824654 SRR21853496 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853496 SRR21853496_1.fastq Input file: SRR21853496_1.fastq trimmed: SRR21853496-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:16:39 2024 >> started Fri Dec 6 16:16:50 2024 >> done (10.818s) 21615830 reads processed; of these: 10 ( 0.00%) short reads filtered out after trimming by size control 70789 ( 0.33%) empty reads filtered out after trimming by size control 21545031 (99.67%) reads available; of these: 561 ( 0.00%) trimmed reads available after processing 21544470 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 9 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 4 0.00% 25 3 0.00% 26 0 0.00% 27 5 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 1 0.00% 32 8 0.00% 33 9 0.00% 34 7 0.00% 35 74 0.00% 36 87 0.00% 37 101 0.00% 38 106 0.00% 39 100 0.00% 40 120 0.00% 41 109 0.00% 42 89 0.00% 43 118 0.00% 44 108 0.00% 45 127 0.00% 46 102 0.00% 47 98 0.00% 48 112 0.00% 49 138 0.00% 50 128 0.00% 51 144 0.00% 52 127 0.00% 53 154 0.00% 54 168 0.00% 55 163 0.00% 56 164 0.00% 57 154 0.00% 58 182 0.00% 59 183 0.00% 60 186 0.00% 61 205 0.00% 62 190 0.00% 63 194 0.00% 64 233 0.00% 65 174 0.00% 66 214 0.00% 67 199 0.00% 68 238 0.00% 69 181 0.00% 70 154 0.00% 71 222 0.00% 72 194 0.00% 73 181 0.00% 74 249 0.00% 75 230 0.00% 76 224 0.00% 77 226 0.00% 78 255 0.00% 79 256 0.00% 80 271 0.00% 81 289 0.00% 82 268 0.00% 83 289 0.00% 84 325 0.00% 85 337 0.00% 86 350 0.00% 87 360 0.00% 88 394 0.00% 89 446 0.00% 90 560 0.00% 91 1350 0.01% 92 534 0.00% 93 705 0.00% 94 1491 0.01% 95 5330 0.02% 96 29377 0.14% 97 100015 0.46% 98 391891 1.82% 99 1442596 6.70% 100 4910655 22.79% 101 14649766 68.00% 21545031 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=225.99 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=21.3 sequence=CCGCCGCCGCCA Started job on | Dec 06 16:17:07 Started mapping on | Dec 06 16:17:07 Finished on | Dec 06 16:17:48 Mapping speed, Million of reads per hour | 1891.76 Number of input reads | 21545031 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 19406843 Uniquely mapped reads % | 90.08% Average mapped length | 100.21 Number of splices: Total | 6923511 Number of splices: Annotated (sjdb) | 6538280 Number of splices: GT/AG | 6829060 Number of splices: GC/AG | 76957 Number of splices: AT/AC | 3736 Number of splices: Non-canonical | 13758 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 680053 % of reads mapped to multiple loci | 3.16% Number of reads mapped to too many loci | 979792 % of reads mapped to too many loci | 4.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1458135 1458135 1458135 N_multimapping 680053 680053 680053 N_noFeature 967192 10100116 10026405 N_ambiguous 278603 15429 17292 UnstrandedReadsAssigned:18161048 PositiveStrandReadsAssigned:9291298 NegativeStrandReadsAssigned:9363146 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853496 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853496-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,545,031 reads, 18,797,477 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR21853496.ke.tsv 35125 SRR21853496.se.tsv 88098 total ==> SRR21853496.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 137.953 14.806 PNS24247 1044 945 21.1317 2.00879 PNS24249 1928 1829 134.939 6.62763 PNS24246 1044 945 21.1317 2.00879 PNS24248 1044 945 21.1317 2.00879 PNS24244 1471 1372 11.7132 0.766926 PNS24243 293 194 11 5.0936 KQK14069 1603 1504 7591.46 453.431 KQK14071 474 375 906.831 217.234 ==> SRR21853496.se.tsv <== BRADI_1g14170v3 8818 BRADI_1g53295v3 100 BRADI_1g59795v3 318 BRADI_1g07683v3 0 BRADI_1g00485v3 57 BRADI_1g20270v3 692 BRADI_1g74790v3 145 BRADI_1g09890v3 0 BRADI_1g77505v3 157 BRADI_1g48960v3 0 SRR21853496 completed mapping pipeline successfully