Starting /dee2/code/volunteer_pipeline.sh SRR21853497 current disk space = 1550567317504 free memory = 1376369780 SRR21853497 SRAfilesize a687dfbf9eee129a3a39a2b2654b5eca SRR21853497.sra SRR21853497.sra file validated SRR21853497 is single end SRR21853497 is conventional basespace SRR21853497 read1 length is 35-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 35-101 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.17225 37.0 37.0 37.0 25.0 37.0 2 34.6605 37.0 37.0 37.0 25.0 37.0 3 35.54525 37.0 37.0 37.0 37.0 37.0 4 35.62925 37.0 37.0 37.0 37.0 37.0 5 35.75125 37.0 37.0 37.0 37.0 37.0 6 35.73725 37.0 37.0 37.0 37.0 37.0 7 35.55975 37.0 37.0 37.0 37.0 37.0 8 35.83225 37.0 37.0 37.0 37.0 37.0 9 35.89875 37.0 37.0 37.0 37.0 37.0 10-11 35.9335 37.0 37.0 37.0 37.0 37.0 12-13 35.78725 37.0 37.0 37.0 37.0 37.0 14-15 35.825 37.0 37.0 37.0 37.0 37.0 16-17 35.81675 37.0 37.0 37.0 37.0 37.0 18-19 35.7285 37.0 37.0 37.0 37.0 37.0 20-21 35.78475 37.0 37.0 37.0 37.0 37.0 22-23 35.826 37.0 37.0 37.0 37.0 37.0 24-25 35.79375 37.0 37.0 37.0 37.0 37.0 26-27 35.5265 37.0 37.0 37.0 37.0 37.0 28-29 35.64075 37.0 37.0 37.0 37.0 37.0 30-31 35.612 37.0 37.0 37.0 37.0 37.0 32-33 35.664500000000004 37.0 37.0 37.0 37.0 37.0 34-35 35.7195 37.0 37.0 37.0 37.0 37.0 36-37 35.56239059764941 37.0 37.0 37.0 37.0 37.0 38-39 35.52188047011753 37.0 37.0 37.0 37.0 37.0 40-41 35.52888222055514 37.0 37.0 37.0 37.0 37.0 42-43 35.49337334333583 37.0 37.0 37.0 37.0 37.0 44-45 35.433108277069266 37.0 37.0 37.0 37.0 37.0 46-47 35.50587646911728 37.0 37.0 37.0 37.0 37.0 48-49 35.46236559139785 37.0 37.0 37.0 37.0 37.0 50-51 35.51387846961741 37.0 37.0 37.0 37.0 37.0 52-53 35.56639159789947 37.0 37.0 37.0 37.0 37.0 54-55 35.42510627656914 37.0 37.0 37.0 37.0 37.0 56-57 35.45211302825707 37.0 37.0 37.0 37.0 37.0 58-59 35.40035008752188 37.0 37.0 37.0 37.0 37.0 60-61 35.435858964741186 37.0 37.0 37.0 37.0 37.0 62-63 35.46636659164791 37.0 37.0 37.0 37.0 37.0 64-65 35.48924462231116 37.0 37.0 37.0 37.0 37.0 66-67 35.371935967983994 37.0 37.0 37.0 37.0 37.0 68-69 35.23711855927964 37.0 37.0 37.0 31.0 37.0 70-71 35.228864432216106 37.0 37.0 37.0 31.0 37.0 72-73 35.2456228114057 37.0 37.0 37.0 31.0 37.0 74-75 35.36543271635818 37.0 37.0 37.0 37.0 37.0 76-77 35.29489744872436 37.0 37.0 37.0 31.0 37.0 78-79 35.25412706353177 37.0 37.0 37.0 31.0 37.0 80-81 35.39294647323662 37.0 37.0 37.0 37.0 37.0 82-83 35.35492746373187 37.0 37.0 37.0 31.0 37.0 84-85 35.19409704852426 37.0 37.0 37.0 31.0 37.0 86-87 35.475987993996995 37.0 37.0 37.0 37.0 37.0 88-89 35.38619309654827 37.0 37.0 37.0 37.0 37.0 90-91 35.38894447223612 37.0 37.0 37.0 37.0 37.0 92-93 35.31890945472736 37.0 37.0 37.0 37.0 37.0 94-95 35.22411205602802 37.0 37.0 37.0 31.0 37.0 96-97 35.30696726201966 37.0 37.0 37.0 31.0 37.0 98-99 35.34118267255781 37.0 37.0 37.0 37.0 37.0 100-101 35.31725553520357 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 3.0 24 3.0 25 3.0 26 13.0 27 29.0 28 35.0 29 52.0 30 66.0 31 102.0 32 120.0 33 221.0 34 308.0 35 561.0 36 2116.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.707176794198553 12.578144536134033 17.97949487371843 40.735183795948984 2 24.669042769857434 20.264765784114054 31.28818737270876 23.778004073319757 3 27.93198299574894 21.85546386596649 22.85571392848212 27.35683920980245 4 27.25681420355089 29.43235808952238 18.779694923730933 24.5311327831958 5 28.832208052013 30.682670667666915 20.205051262815704 20.280070017504375 6 22.95573893473368 33.05826456614154 21.180295073768445 22.80570142535634 7 19.504876219054765 16.704176044011003 39.6099024756189 24.18104526131533 8 23.005751437859466 22.18054513628407 25.056264066016503 29.75743935983996 9 22.85571392848212 22.080520130032507 26.881720430107524 28.182045511377847 10-11 26.03150787696924 28.34458614653663 19.679919979995 25.943985996499126 12-13 25.11877969492373 22.630657664416105 25.668917229307326 26.581645411352838 14-15 25.243810952738183 24.643660915228807 25.256314078519633 24.85621405351338 16-17 25.543885971492873 25.006251562890725 24.33108277069267 25.11877969492373 18-19 25.731432858214554 24.218554638659665 24.006001500375092 26.04401100275069 20-21 25.23130782695674 25.331332833208304 25.35633908477119 24.081020255063766 22-23 25.531382845711427 24.593648412103025 24.256064016004 25.618904726181547 24-25 25.531382845711427 24.893723430857715 24.593648412103025 24.981245311327832 26-27 24.956239059764943 24.468617154288573 24.418604651162788 26.156539134783696 28-29 25.84396099024756 25.506376594148538 23.605901475368842 25.04376094023506 30-31 24.168542135533883 24.956239059764943 25.468867216804203 25.406351587896975 32-33 24.218554638659665 26.25656414103526 23.15578894723681 26.36909227306827 34-35 24.956239059764943 25.756439109777446 23.78094523630908 25.506376594148538 36-37 25.6064016004001 25.268817204301076 24.18104526131533 24.943735933983497 38-39 24.756189047261813 24.18104526131533 24.656164041010253 26.406601650412604 40-41 25.731432858214554 25.30632658164541 24.668667166791696 24.293573393348336 42-43 24.5311327831958 24.8062015503876 26.419104776194047 24.243560890222557 44-45 24.981245311327832 24.381095273818453 25.393848462115532 25.243810952738183 46-47 25.918979744936234 24.243560890222557 23.74343585896474 26.094023505876468 48-49 24.431107776944234 24.543635908977244 25.28132033008252 25.743935983995996 50-51 24.918729682420604 25.456364091022753 25.081270317579396 24.543635908977244 52-53 25.131282820705174 24.243560890222557 24.193548387096776 26.431607901975497 54-55 24.493623405851466 24.143535883970994 24.99374843710928 26.36909227306827 56-57 25.76894223555889 23.88097024256064 24.781195298824706 25.568892223055762 58-59 25.431357839459867 23.830957739434858 26.006501625406354 24.731182795698924 60-61 25.04376094023506 24.5311327831958 25.543885971492873 24.88122030507627 62-63 25.18129532383096 23.718429607401852 25.693923480870218 25.406351587896975 64-65 26.050525262631314 24.149574787393696 24.68734367183592 25.11255627813907 66-67 25.0 25.437718859429715 24.54977488744372 25.012506253126567 68-69 25.82541270635318 24.64982491245623 24.674837418709355 24.84992496248124 70-71 26.475737868934466 24.84992496248124 23.761880940470235 24.912456228114056 72-73 26.500750375187593 25.350175087543768 23.936968484242122 24.212106053026513 74-75 26.500750375187593 24.937468734367183 23.261630815407706 25.30015007503752 76-77 27.52626313156578 23.59929964982491 24.524762381190595 24.349674837418707 78-79 26.43821910955478 25.775387693846923 24.374687343671837 23.411705852926463 80-81 26.063031515757878 24.387193596798397 24.262131065532767 25.287643821910955 82-83 26.150575287643825 23.999499749874936 24.674837418709355 25.175087543771884 84-85 25.887943971985994 24.462231115557778 24.149574787393696 25.50025012506253 86-87 26.013006503251624 24.374687343671837 25.0 24.61230615307654 88-89 26.513256628314156 23.449224612306153 25.60030015007504 24.437218609304654 90-91 25.900450225112557 24.424712356178087 24.77488744372186 24.899949974987493 92-93 26.76338169084542 24.83741870935468 24.262131065532767 24.137068534267133 94-95 24.77488744372186 24.499749874937468 25.0 25.72536268134067 96-97 26.11090249092502 24.421078983602452 24.946801852547253 24.521216672925274 98-99 25.537053514681578 23.808313207067496 25.066734460404223 25.5878988178467 100-101 26.93153266331658 10.819723618090451 31.501256281407038 30.747487437185928 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 2.0 27 2.0 28 1.5 29 6.0 30 8.0 31 8.0 32 9.0 33 9.0 34 16.5 35 27.5 36 40.5 37 54.0 38 65.5 39 77.5 40 87.5 41 93.0 42 110.5 43 142.0 44 155.0 45 151.0 46 146.5 47 170.0 48 187.0 49 174.0 50 178.5 51 190.0 52 186.5 53 186.5 54 173.0 55 155.0 56 155.0 57 144.5 58 119.5 59 96.5 60 77.0 61 66.5 62 62.0 63 47.5 64 48.0 65 51.0 66 53.0 67 56.5 68 40.5 69 31.0 70 31.5 71 24.0 72 21.0 73 17.0 74 14.0 75 9.5 76 4.0 77 4.5 78 5.0 79 3.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 1.7999999999999998 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-11 0.025 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.025 32-33 0.025 34-35 0.025 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 34-35 1.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 1.0 96-97 31.0 98-99 358.0 100-101 3608.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.8888269713012 81.55 2 8.02451936472555 14.399999999999999 3 0.6965728615213151 1.875 4 0.27862914460852606 1.0 5 0.02786291446085261 0.125 6 0.02786291446085261 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05572582892170522 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 24 0.6 TruSeq Adapter, Index 1 (97% over 36bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCGCGTAT 12 0.3 TruSeq Adapter, Index 1 (97% over 36bp) GCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAGTA 6 0.15 No Hit CAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916468 spots for SRR21853497.sra Written 916468 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra Read 916450 spots for SRR21853497.sra Written 916450 spots for SRR21853497.sra SRR ids: ['SRR21853497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_br8lj04z SRR21853497.sra spots: 18329018 blocks: [[1, 916450], [916451, 1832900], [1832901, 2749350], [2749351, 3665800], [3665801, 4582250], [4582251, 5498700], [5498701, 6415150], [6415151, 7331600], [7331601, 8248050], [8248051, 9164500], [9164501, 10080950], [10080951, 10997400], [10997401, 11913850], [11913851, 12830300], [12830301, 13746750], [13746751, 14663200], [14663201, 15579650], [15579651, 16496100], [16496101, 17412550], [17412551, 18329018]] SRR21853497 file size 4936176 SRR21853497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853497 SRR21853497_1.fastq Input file: SRR21853497_1.fastq trimmed: SRR21853497-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 16:19:15 2024 >> started Fri Dec 6 16:19:25 2024 >> done (10.195s) 18329018 reads processed; of these: 37 ( 0.00%) short reads filtered out after trimming by size control 171057 ( 0.93%) empty reads filtered out after trimming by size control 18157924 (99.07%) reads available; of these: 288 ( 0.00%) trimmed reads available after processing 18157636 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 7 0.00% 31 6 0.00% 32 6 0.00% 33 2 0.00% 34 3 0.00% 35 108 0.00% 36 92 0.00% 37 114 0.00% 38 123 0.00% 39 125 0.00% 40 115 0.00% 41 118 0.00% 42 123 0.00% 43 94 0.00% 44 105 0.00% 45 98 0.00% 46 110 0.00% 47 124 0.00% 48 112 0.00% 49 103 0.00% 50 132 0.00% 51 146 0.00% 52 111 0.00% 53 141 0.00% 54 138 0.00% 55 171 0.00% 56 174 0.00% 57 171 0.00% 58 196 0.00% 59 198 0.00% 60 212 0.00% 61 235 0.00% 62 241 0.00% 63 205 0.00% 64 203 0.00% 65 245 0.00% 66 291 0.00% 67 245 0.00% 68 303 0.00% 69 306 0.00% 70 295 0.00% 71 269 0.00% 72 340 0.00% 73 377 0.00% 74 375 0.00% 75 387 0.00% 76 416 0.00% 77 433 0.00% 78 415 0.00% 79 492 0.00% 80 524 0.00% 81 546 0.00% 82 542 0.00% 83 593 0.00% 84 656 0.00% 85 656 0.00% 86 743 0.00% 87 812 0.00% 88 798 0.00% 89 922 0.01% 90 952 0.01% 91 3252 0.02% 92 1640 0.01% 93 1754 0.01% 94 1942 0.01% 95 4285 0.02% 96 21405 0.12% 97 91183 0.50% 98 327734 1.80% 99 1253811 6.91% 100 4231780 23.31% 101 12201817 67.20% 18157924 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=23 prefix-density=0.81 prefix-fanout=2.1 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=8.22 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=1.9 sequence=GGATCACTAAGACCTACTTTCGTACCTGCTCGACTTGT Started job on | Dec 06 16:19:48 Started mapping on | Dec 06 16:19:48 Finished on | Dec 06 16:21:01 Mapping speed, Million of reads per hour | 895.46 Number of input reads | 18157924 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 11293997 Uniquely mapped reads % | 62.20% Average mapped length | 100.18 Number of splices: Total | 4016475 Number of splices: Annotated (sjdb) | 3792527 Number of splices: GT/AG | 3960169 Number of splices: GC/AG | 46091 Number of splices: AT/AC | 2283 Number of splices: Non-canonical | 7932 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2311849 % of reads mapped to multiple loci | 12.73% Number of reads mapped to too many loci | 2584309 % of reads mapped to too many loci | 14.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.84% % of reads unmapped: other | 2.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4552078 4552078 4552078 N_multimapping 2311849 2311849 2311849 N_noFeature 772302 5922089 5992898 N_ambiguous 177112 12742 14157 UnstrandedReadsAssigned:10344583 PositiveStrandReadsAssigned:5359166 NegativeStrandReadsAssigned:5286942 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853497 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853497-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,157,924 reads, 11,588,306 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR21853497.ke.tsv 35125 SRR21853497.se.tsv 88098 total ==> SRR21853497.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 96.206 13.8288 PNS24249 1928 1829 77.0353 5.72124 PNS24246 1044 945 96.206 13.8288 PNS24248 1044 945 96.206 13.8288 PNS24244 1471 1372 98.3467 9.73688 PNS24243 293 194 9 6.30166 KQK14069 1603 1504 5597.77 505.57 KQK14071 474 375 1472.51 533.386 ==> SRR21853497.se.tsv <== BRADI_1g14170v3 7979 BRADI_1g53295v3 64 BRADI_1g59795v3 390 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 190 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 167 BRADI_1g48960v3 0 SRR21853497 completed mapping pipeline successfully